Salman avestimehr phd thesis

Publicado em Agosto 2017

The LOD, estimated according to the microplate reader measurements, which had been measured in standard microplate cells, not in the prototype chip, was: 1. In this system, the shuttling sub microliter sample of the PCR mixture moves back and forth over three constant temperature zones by pneumatic actuation with integrated system. Eye) and biochemical laboratory testing at the point of care (POC). 7 pmol FITC). 25x10-2 ) (32 pmole) The fluorescence intensities for the FITC standards solutions were also measured using the prototype photo-detector and then a calibration curve was plotted. 2. A pneumatic micropump was used to precisely drive the sample flowing through three reaction chambers. The light from the LED uniformly illuminates the detection region from the side of the chip on the chip while the photo-detector detects the fluorescent emission at 90 degree, i. The system proposed in this project is similar to the model described by Fery et al, (2007). 134 157 Experimentally, the LOD was also detected by preparing low concentrations of FITC in a range of (1. The equation created was used as the basic equation to operate the thermistor before it had been calibrated. 55 79 overcome these issues, great efforts have been made to develop a multi-chamber stationary PCR. This time is not including the heating or cooling time. 3 outlines the temperature capacity of different types of the proposed materials, which could be used to create the sample chamber Table 3. Electrochemiluminescence is the ability of the substance to emit light when stimulated by an electric field. The functional annealing temperature is 5 degrees below the melt temperature of the primers used. Whereas in our proposed system the sample chamber (which contains the PCR mixture), is mechanically shunted in between the three heaters. 7B. Electrochemistry-based detection method is an alternative method of choice for hand-held instruments. The double-stranded DNA was separated into two single strands by heating it to ~94 C. Large sample plugs were injected for these sensitivity measurements, so that the dispersion effects did not cause dilution of the maximum achievable sample fluorescence. (3) The rate at which the PCR solution travels between different temperature zones are difficult to regulate, and thus most of the continuous-flow PCR systems lack the flexibility to regionally control fluid flow velocity to meet different PCR requirements. 6 Schematic diagram of silicon glass, single chamber microchip for real time PCR (Lee et al, 2006) 46 69 When the nucleic acids extraction method is applied it provides efficient cell lyses and nucleic acid isolation for various pathogen detections. Absolute real-time PCR is a quantitative PCR method for the determination of concentration of PCR templates such as DNA in a PCR reaction. For instance, a fluorescence detection system was incorporated with a capillary PCR system for on-line detection 115 138 of PCR products (Lee et al, 2004). However, as can be seen in Figure 4. "So for the first time, my sadness was no longer considered a punishable offense, but as an evil that had unintended official recognition as a nervous state that I was not responsible, I had relief have more qualms about mixing the bitterness of my tears, I could... As can be seen in Figure 4. Therefore, it shows good robustness and. Figure 3. In this process the cycle time is less and the holding time depends upon the application. These oligonucleutides are now termed primers. Introducing miniaturised systems into analytical and bio-analytical laboratories could improve the analytical techniques by reducing the size of equipment, reducing the time of the analysis and automating the systems. The system is controlled by the following options: 1) Light Source Power: the LED power supply unit controls the excitation intensity, which will grow with increasing power. The body of the chip was built using polycarbonate (PC) sheet (1-mm thickness) and film (127-micron thickness). This design can be recognized as the first stationery based chamber PCR in a chip. Kim et al, (2006) demonstrated a compact device using an OLED a slight source and an integrated p-i-n photodiode as a detector, with interference filter to mask the excitation light and secured a LOD of 10 µm of TAMRA dye. An interaction with the surface can impede the biochemical components and slow down or inhibit the reaction (Christensen et al, 2007). The third reason is related to PCR kinetics as the sample attains the targeted temperature in each step of the PCR process without over-shooting, which affects the PCR amplification. 3). However, special care must be taken to achieve the thermal optimization of a chamber array in order to obtain homogeneous temperature fields between chambers. This gives the elastomers a more flexible nature and easy handling. Longer extension times for early thermal cycles are helpful for complete amplification because more templates are made in the early thermal cycles, resulting in higher amplification rates and greater specificity (Wittwer, at el, 1990). To make further progress, we present a linear finite-field deterministic channel model which is analytically simpler than the Gaussian model but still captures two key wireless channels: broadcast and superposition. Therefore, major factors affecting the reproducibility and comparability of PCR must be considered and controlled to set up reliable PCR based assays. 158 183 5. 1 When the proportionality constant is inserted then: (Fourier's law) 102 126 Temperature ( C) Temperature ( C) MINIATURISED SYSTEM FOR DNA ANALYSIS 2012 stay at the denaturising stage for not less than 20 seconds, at the annealing stage for not less than 45 seconds and at the extension stage for not less than 30 seconds. 7 Detection method One of the major challenges associated with the development of a nucleic acid analyzer on a chip is to meet the physical limitations required by a portable detection module for on-line PCR detection and quantization. Once the molten polymer has been injected into the mould, the mould is then slowly cooled to harden the polymer. 17 Based on data shown in Figure 4. In addition, power consumption of the proposed thermal-cycler is small, and the device is capable of being integrated in battery supplied portable compact analysis or diagnostic systems. The resulting fluorescence is filtered by dichroic filter (Filter Wratten, Edmund optics, from Kodak, USA) to maximize transmission of the emission signal and eliminate excitation signal and coherent interference artefacts emission. Initial optimization of the system setup was performed using FITC and the results were verified using HR 4000 Ocean Optic spectrometer. 136 159 However, in order to estimate the LOD detection using prototype photo-detector, serial low concentrations of FITC solutions were prepared. In the PCR method, the technique does not target the regulator genes but focuses on the artificially introduced DNA sequences. 5 ml each and used for chromosomal DNA extraction using CTAB (Hexadecyl Trimethyl Ammonium Bromide) extraction method (Murray HG and Thompson, 1980). Temperature cycling protocol for DNA amplification can be divided into six segments: three end point temperatures and three temperature transitions. After two hours, the temperature diminished by 10 degree centigrade gradually every 15 minutes in anticipation of room temperature. The detection limit achieved was 7. The biochip has been designed and custom built by Network Biosystem (Netbio). 2. The PC parts were well cleaned, prior to use, by soaking them with decon 90. 21 Principle of sample shuttling: The PCR reaction is performed inside a straight channel ending in a chamber with a membrane which is deflected to move the liquid sample back and forth over three constantly heated regions. James Watson, Francis Crick, and Maurice Wilkins elucidated the structure of the DNA molecule in The DNA molecule is a linear polymer made up of deoxyribonucleotide repeating units (composed of the sugar 2-deoxyribose, phosphate, and a Purine or pyrimidine base). In addition, rapid heat transfer from the heating block to the in-tube sample liquid ensures high efficiency of amplicon multiplication; for that reason, a thermal processor should guarantee temperature uniformity for all samples within an individual run as well as run-to-run repeatability (Easley et al. The prototype thermalcycler and PCR chip were used successfully to amplify the three sizes and the results were compared with same fragments amplified on a conventional PCR. 2 summarize the similarity and the differences between the proposed design and the other published designs. 104 127 Therefore, the ideal material used to fabricate the PCR chamber must be chemically, mechanically and optically suited to the PCR reaction and the thermal cycler design. 1 List contains the parameters of the thermal-cycler program which used for temperature measurements Table 3. The lower FITC standards solutions prepared are shown in Table 4. Thermal-cycling within the microfluidic chip was achieved by programmable shunting of the chip between three double side temperature zones with different temperatures to accomplish the denaturation, annealing and elongation steps necessary for PCR amplification. 74 99 machines selected to perform this test are: Progene model (model No. DNA is the carrier of genetic information, which is encoded in the sequence of bases; it is present in chromosomes and chromosomal material of cell organelles such as mitochondria and chloroplasts, and also present in some viruses. The complete setup (Figure 4. The light is directly coupled into the system, which is optimized for use close to the chip. (B) Photograph of the flow-through PCR chips with microthermal and microfluidic control modules. The first step of this process is to spin coat a thin layer of the UV sensitive photoresist, (Photoresists are polymeric compounds which are sensitive to UV light causing the structure of the polymer to change through UV exposure), (A). Avestimehr phd in the thesis, salman avestimehr ieee. 19 Emission spectrophotmetric peaks of different concentrations of FITC in the range 0 15x10-3 ng ml -1. The system proposed was developed to reduce cooling and heating times for a PCR process. 3. In the hot 38 61 embosser the master dye and the substrate are heated separately under a vacuum. Cycling should be achieved in seconds rather than minutes. SAW Surface Acoustic Waves is a fabrication technique used to develop passive wireless sensors. Metals can be deposited onto a substrate through either physical or chemical layer deposition techniques. The orthogonal fluorescence detection setup applied is the best setup position to obtain the maximum fluorescence signal from the chip-reaction chamber. 51 75 2. 0 degree per second and decreased in the rate of ~2. In dry etching, the surface of the exposed substrate is etched away either through ion bombardment or by chemical reaction (Madou, 2002). Many thank to the entire Laboratory and the workshop technicians in Teesside University specially those who supported me in any respect during the completion of the project. Three zones microchambers. Certain molecular machines (systems) to produce the proteins required by an organism interpret the sequence of the four nucleic acids. The primers bind to the DNA and mark it in such a way that the addition of DNA polymerase and deoxynucleoside triphosphates (dntps) causes a new strand of DNA to form which is complementary to the target section of DNA. 1 summarised the background information of the primer sets. Both signals were detected by injecting PBS buffer into the chip reaction chamber and detection followed the experimental setup described in section The detection limit was investigated for both the FITC and the dsdna standards solutions. Time spent in transitions is usually wasted, although theoretically a slow transition between annealing and extension may be useful for a poorly annealing primer. 77 100 Figure 3. (c) The actual chip produced. Recently, several studies have proposed microfluidic PCR utilizing a thermal convection. 8 Schematic diagram of the ray tracing of the experimental setup for the fluorescence detection unit; the diagram shows the 90 degree position of the chip between the light source and fluorescence collection. (2) The possibility of producing a disposable chamber. Then, we consider a model for a wireless relay network with nodes connected by such deterministic channels, and present an exact characterization of the end-to-end capacity when there is a single source and a single destination and an arbitrary number of relay nodes. A wrong temperature during the annealing step will result in primers not binding to the template DNA at all, or binding at random. The primary annealing step is a sensitive and a specific step, which characterizes the success of the reaction. The temperature and time needed for annealing depend on the composition of the base, target DNA length 5 28 and concentration of the primers. Figure 2. Many thanks and appreciation offered to my adviser Dr. 3) Alignment: the light path within the chip can be optimized and fixed at the optimum position for the following measurements. Most of the early-miniaturized PCR devices were fabricated in silicon or glass by taking advantage of well-established micro-fabrication technologies. This arrangement guarantees that the detector will collect most of the emitted light. 4 Conclusion The driving force behind the increasing development of miniaturized PCR thermal cycler system is certainly due to their potential commercialization, but the challenge is the production of practical higher performance and throughput design. Salman Rushdie Thesis Topic, Writing Dissertations on Salman Rushdie, and Ph. Some of these steps require treatment of the sample contexts with chemicals. In year 1994 was first introduced this model and after that several attractive models were presented. Consequently, the thermal cycler s correct temperature setup is a vital factor of the PCR results and the attainment of one block for heating and cooling between the PCR steps. 2. A search in PubMed database shows that there was a 30-fold increase in the number of publications within the last decade (Becker and Gärtner, 2008). Besides my advisor, I would like to thank the other supervisors, Prof. G. As the PCR system requires three different temperature zones, the temperature differences within the closed loop give rise to buoyancy differences and the liquid reactant continuously circulates along the closed loop by the thermosiphon effect (Chung et al, 2010). 3 A circular ferrofluid driven micro-chip (Sun, Kwok, and Nguyen,2007) 4 PCR system operated using thermosiphon effect (Cheng et al. 29 53 Number of articles published MINIATURISED SYSTEM FOR DNA ANALYSIS 2012 Chapter 2 Literature review 2. The chip is connected with amplification and detection units. Lysis buffer was prepared by dissolving 200 µg of proteinase K (Sigma Aldrich, UK) in 10 ml of 0. The length of this tube is varied according to the number of cycles required; the range is between 35 to 65 cycles depending upon the application. Both techniques are efficient and commonly applied methods. 2 Schematic of the prototype device, the lift side shows the amplification unit which include three heaters, each heater has a constant temperature. The number of thermal cycles can be varied by controlling the number of rotation cycles of the magnet. The Fluorescence intensity is defined from the chemical properties of FITC which absorbs the light at 480 nm and emits at 520 nm. 49 73 larger heat transfer rate between the PCR sample and temperature-controlled components. The temperature of this stage depends on the primers and is usually 5 C below their melting temperature between C. Functionally, this is accomplished by heating and melting double-stranded (hydrogen bonded) DNA into single-stranded (non-hydrogen bonded) DNA and producing an oligonucleotide primer complementary to each DNA strand. 1. The disc, which contained the sample chambers, was sandwiched between the two thermal-cycling plates. LED light-emitting diode is a semiconductor light source. Figure 4. The system compressed three temperature zones. 19 Emission spectrophotmetric peaks of different concentrations of FITC in the range 0 15x10-3 ng ml-1 The measurements were taken using HR4000 ocean optic spectrometer; it is clear that there is a significant signal development at wavelength 523 nm Figure 4. 10, a thermal cycler builds on three separated heating zones. The surname Anzaldua is of Basque origin. 3. For example, in using nucleic acid purification through solid-phase extraction (SPE) from blood samples, the major challenge associated with integrating sample treatment steps into a microfluidic design is the incompatibility of SPE reagents (guanidine and iso-proponal) with the PCR process. In chapter two of this thesis the kinetic of PCR will be discussed in more details. The emission efficiency is expressed by the quantum yield (Ф) which is defined as the ratio of the number of photons emitted to the number of photons absorbed by the dye (Bustin, 2004). All four dntps are substrates, pyrophosphate (PP) is released, and the deoxynucleoside monophosphate (dnmp) is linked to the 3'-OH of the primer chain through formation of a phosphodiester bond. 1 Jablonski diagram illustrating the excitation and emission is taken place inside the nucleus of the fluorophore molecule. (Zhang, Xing and Xu, 2007). 8: Final chip design with fluid inputs and outputs and functional regions labelled (Budge et al, 2009). Moreover, advanced research institutions invested greatly in nanotechnology research centres in order to develop cutting edge technology. Therefore, there is s demand for cutting edge technology in this field. The Rotorgene uses an air heating and cooling technique and the samples are subjected to the air stream of the step temperature. 20 and Figure 4. , the smallest concentration of an analyte for which we can decide whether that analyte is present or not in the sample under test. The diversity of genetically altered crops most certainly will increase and, therefore, analytical demands will continue to increase as well (Meyer, 1999) PCR is the best tool to detect pathogen viruses, which are currently the most public concern problem, especially the communicable diseases, such as influenza viruses or swine flu (H1N1) and sexual diseases, such as the human immunodeficiency virus (HIV). Thesis Proposalsalman avestimehr phd thesis salman avestimehr phd thesis …... Most devices investigated were utilise bulky bench-top excitation sources, including lasers and mercury lamps. 1 Introduction Robust portable PCR systems for point-of-care applications and pathogen detection in the field could supplement or replace expensive bench top laboratory apparatus. Moreover, a too high or too low denaturation temperature may lead to an obvious loss of polymerase enzyme activity, which can also reduce the yield of amplified product. This led to an obvious increase in the overall quality of the study performances. Fast DNA amplification is achieved by the system produced because it significantly improves the ramping rate of heating and cooling the PCR mixture. The average cycling time is less than 60 s and typical 40 cycle PCR reactions could be performed in 35 min xv 18 Figure 5. 21 Temperature profile of Al and film chamber achieved by our thermal cycler system. A blue-light LED was employed as the excitation light source, with a peak emission at a wavelength of 470 nm. Cycle time of the PCR mixture is adjusted by changing the rotation speed of the magnet. Most molecules are doublestranded and anti-parallel, resulting in a right-handed helix structure that is held together by hydrogen bonds between a purine on one chain and pyrimidine on the other chain. The temperature of the experiment can affect the fluorescence efficiency of the fluorophore because a raised temperature can increase the collision relaxation of the molecules (Skoog et al, 2004) Fluorescence and DNA detection DNA binding dyes, such as SYBR Green I, are fluorophore compounds. 3 Diagram showing the lift-off process for positive and negative photo-resists process. The plot illustrates the DNA concentrations vs. 35) meaning that the number of cycles is not variable. The method used for comparison was gel electrophoresis. 2 : The FITC concentrations were prepared for LOD detection experimentally in the chip system for Ocean optic spectrophotometer Table 4. One often marvels at the wonders of colonialism and what it has supposedly achieved for the natives of the colonies. Most critiques of diasporic theory focus mainly on its cultural variation and its claimed advantage of extraordinary bourgeois or cosmopolitan representations of settlement and migration (Mark, 2008). Besides, the ability to achieve a disposable, reliable PCR on a chip will facilitate its use in applications such as pathogen detection, forensic investigations and food control testing (Christensen, 2007). Lab-on-a-chip (LOC) and Micro Total Analysis Systems (μtas) are becoming of great interest amongst research groups. The error is in the range between 1. The entire device 45 68 was then rinsed thoroughly with distilled water and the PCR and SPE fields dried with nitrogen (Easley et al, 2006). The complete form of the thermal-cycler consists of two identical plates connected by an angle hinge as in Figure 3. The future enhancement of the system would be focussed on increasing its performance by: 1) Lowering background noise to reach lower LODs; 2) Enhancing the detector sensitivity for an excitation source with optimal properties; 3) Improving the collection of light in the microfabricated system; 150 178 Figure 5. Excitation light intensity will increase with the rating of the LED power. It is, also a highly sensitive and specific methodology for the detection of nucleic acids and a useful tool for quantification of the amount of specific nucleic acid present in a target sample. 5x10-3 ) 0. Poly (dimethysiloxane)(pdms) is the most popular example of elastomeric polymers. The excitation light source and spectrometer are employed to provide excitation and fluorescence spectral 125 148 desperation for DNA binding dye (fluorophore) detection. Anzaldua is a successor of numerous of the protuberant Basque and Spanish travelers and colonizers to originate to the Americas in the 16th and 17th centuries. Therefore, experimentally the lower detection of the dsdna estimated on the photo-detector was 100 ng ml 172 4. Each single zone has a unique temperature. Analysis of deoxyribonucleic acid (DNA) has been enhanced by use of the polymerase chain reaction (PCR) technique, which is now a widely used tool for in vitro amplification of nucleic acids. The operation of the sensor depended on the fluorescence binding dye. Thermoplastics are those, which soften and flow upon heating, typical examples of thermoplastic polymers being polyethylene (PE), polypropylene (PP), nylon, polymethyl methacrylate (PMMA), polystyrene (PS) polycarbonate (PC) polyvinylchloride (PVC), polyethylenetetraphthalate glycol (PETG), cycloolefin copolymer (COC) and polyimide. 8 ng µl - 1 (180 ng ml -1 ). Using a cut off tip remove the top aqueous layer into a clean Eppendorf tube. 3 Construction of the first prototype device Altering the system design The second prototype thermal-cycler design and fabrication The third prototype design and fabrication Results and discussion Thermistors calibration method Thermal-cycler temperature profile Thermal-cycler prototype design Chip fabrication Materials and method Results and discussion Conclusion Chapter 4 Detection system Introduction Theoretical background Fluorescence spectroscopy Fluorescence and DNA detection Materials and methods Design of the system In-situ Photo-detector Data acquisition uni Proof of Concept Demonstration Geometric Placement of the Detector Optimization of Fluorescence Detection: System Calibration Optimisation of Fluorescence Detection: Limit of Detection using FITC vi 9 Fluorescence Test on the Prototype Device Results and discussion The Benchmark Test PCR test Primer Set Gel Electrophoresis Results Fluorescence Results PCR test Primer set Gel Electrophoresis Results Fluorescence Results PCR Primer set Gel Electrophoresis Results Fluorescence Results Conclusion Chapter 6 Future work Introduction Device Relational Future work to improve the thermal-cycler design Future work in chip Future work in the detection unit Device application References Appendix1 Thermistor calibration equation Appendix 2 Experimental data for Fluorescence measurements Appendix 3 NCBI Information of the designed primers viii 16 Figure 4. 4) The system will comprise the encapsulation of all PCR components (enzyme, nucleotides, buffer and salman avestimehr phd thesis primers) in a sealed and sterile environment, which only needs to be penetrated once for the injection of template DNA. E. The range of most available dyes is in between 10,000 to 250,000 cm -1 M -1. 6 is a lock-in system which consists of three main parts: an analogue to digital converter 117 142 Figure 4. The system consists of two major components, namely a micro temperature control module and a microfluidic control module. Generally, the ideal amplification can be managed in between 25 to 40 cycles (Harris and Jones, 1997): However, a more sensitive PCR-reaction can be achieved using a nested PCR, which usually amplifies the PCR product from the first process with more specific sets of primers. 3 Extension of primers on the DNA template is carried out using a thermo stable DNA polymerase enzyme, which is able to synthesis a complimentary copy of the initial stdna by incorporating of dntps available in the reaction. 3. In 2008 and M. A custom essays whether you can i get to write an author ... The laboratory based study of Young et al. Template: In general terms, it is a pattern that can be copied or its shape reproduced. Each pair of blocks exemplified one thermal cycler phase, as can be seen in Figure 3. This to in order to guarantee that the sample achieves the correct temperature for at least 15 seconds, which is the absolute best reaction time possible in many PCR applications Time (second) Denaturation Annealing Extension Figure 3. (C); strait channel continuous flow. E. Along with the thermal-cycler structure, a fine polycarbonate chip was fabricated. 7 pm of FITC. A fine disposable PCR chip was developed in this work for rapid DNA amplification. Eventually the fluorophore molecule returns to the ground state following the emission of a photon with lower energy level hence longer wavelength. In this review, three models were discussed to evaluate the best practical model with a reasonable cycling rate, in addition to finding out the suitable detection technique. Figure 4. They have a high internal gain and are sensitive detectors for low-intensity applications such as fluorescence spectroscopy. 1 A summarise the nucleotide sequences of the oligonucleotides used and their target genes Table 5. In reference to the discussion in the literature review (chapter two), the comparison between the prototype sample-chamber and other sample-chamber already published summarized in Table 3. At this temperature, the primers attach to the sample DNA sequences that match them. Start Your Doctoral Degree Now. Then the parts were placed in the oven at 105 C for at least 2 hours to dry. Most developments in miniaturisation have stemmed from institutes with strong analytical, engineering and fabrication expertise. 140 164 The same set of reactions, using the assay kit, was also carried out in the micro titre plate but the reaction mixture was individually injected into the chip reaction chamber. As the next temperature cycle begins, the DNA is heated and the newly synthesized strands separate from the original strands. However, as in any optical measurements, the fluorescence detection signals are not steady. 18 (A) Overview of fabrication process used to manufacture micro PCR chips. (skoog et al, 2004). (2013) Miniaturised system for DNA analysis. This level corresponds to the minimal significant signal that can be distinguished from the noisy background signal. Micro injection moulding is capable of producing microstructures as small as several nanometres but is also capable of producing more replicates, when compared to hot embossing, owing to the shorter cycling times needed for this process Laser Ablation Laser ablation is a non contact fabrication technique which does not produce any internal stress on the material that is being processed. Miniaturisation of PCR integrated bioassays potentially possesses all of the desired qualities and comes with additional benefits relating to sample tracking, contamination, and savings in cost and time. The segment of DNA is involved in producing a polypeptide chain. 19: calibration plot for the fluorescence signal of FITC standards were obtained from chip measurements using an ocean optic spectrometer. 3 The FITC concentrations prepared for practically detecting LOD in the chip system for photo-detector. However, an important issue associated with this model is cross-contamination, because the chip was not disposable and it was made from glass and fabricated by high cost technology. The master mix used was as in Table 5. I could not have imagined having a better advisor and mentor for my PhD study. 113 136 Figure 4. In the micro milling system a computer is used to position and move the cutting piece and is often referred to as computer numerical control or CNC milling (Geschke et al, 2004) Micro Injection Moulding Micro injection moulding is similar to hot embossing, resulting in an inverted copy of the mould; however, unlike hot embossing the mould is not pressed into a polymer at its glass transition temperature, and instead the molten polymer material is injected into the mould cavity at pressures between bars. 9) The DNA precipitates were left in the tubes to completely precipitate at room temperature for 30 min. Each set of primers was tested in the conventional PCR machine and in the prototype device. The main targeted market is medical and biomedical applications. Yet colonization is a two-edged sword. The calculation of LOD required the calibration of the measurement system and determination of the background level. 161 Salman Avestimehr Phd Thesis salman avestimehr phd thesisTake The Next Step In Your Career. Aureus detection primer sets xviii 20 Glossary The following important terms have been used frequently in the thesis: Deoxyribonucleic Acid (DNA) The chemical building blocks (molecules) of which genes (i. 5 mm thick squareshaped sheet with 4 mm holes in diameter to form either one well or four wells of the containment of reagents. 112 135 The fluorescence efficiency of these compounds depends on their ability to absorb and emit photons. In addition, emission light intensity will be increased by increasing the power. I thank my fellow lab-mates, Henderson Andrew; Lakey Andrew; Bajuszova Zuzana; Pasirayi, Godfrey; Rashid Mamun; Abujaafar Elhashmi, for the stimulating discussions and for we have had in the last four years. PMMA Poly(methyl methacralate) PTFE Poly Tetrafluoroethlene xx 22 PET Polyethylene terephthalate PP Polypropylene PDMS Poly(dimethylsiloxane) CE Capillary Electrophoresis is a It is the most efficient separation technique available for the analysis of both large and small molecules. Therefore, it was safe to use the thermistor to measure the temperature in the chambers because the temperature needed to be measured in a range between 55 C to 95 C Figure 3. 8 The first attempt of thermistor calibration. These chemicals would inhibit the PCR process, if not separated during the extraction (Li et al, 2009). The microchambers with shapes like square, hexagon, vertically standing rectangle, and horizontally standing rectangle were only filled in the area near the chamber sidewall. However, the nucleotides of the RNA contain Guanine (G), Cytosine(C), Adenine (A) and Uracil (U). 2 Optimisation of Fluorescence Detection System: Limit of Detection Using FITC The performance of a detection system is typically defined by means of the limit of detection (LOD). 21 takes ~9 seconds to rise from ~30 C to ~90 C, ~6 seconds to cool from 93 C to 61 C and 4 seconds to rise from 60 C to ~72 C. 3 The FITC concentrations prepared for practically detecting LOD in the chip system for photo-detector Table 4. 4. The polymer chains untangle if any external force is acting on the polymer and allow the polymer to stretch elastically. 3 The most important models of PCR-on-a-chip, which have been produced and highlight on the model type; the materials used to fabricate the chips and detection technique applied. The signal intersects with all the PCR amplification curves during their exponential phases. The temperatures in each zone represents the three different PCR cycling stages, DNA denaturation at ~ 94 C, DNA annealing at ~45-60 C and DNA extension at ~72 C. However, increasing the number of cycles to 50 or 60 cycles could lead to amplification of specific and nonspecific products (Harris and Jones, 1997). Moreover, scaling-up of pre-existing procedures for higher throughput would not suit continuous environmental monitoring and onsite studies. The key component of the PCR process is the enzyme DNA polymerase, which occurs naturally in living organisms, where it functions to duplicate DNA when cells divide (Larrick, 1997). 14 View of three amplification cycles on the third prototype thermal-cycler device. However, this intelligent microchip method is not useful in the extraction of nucleic acid from animal or plant tissues because the tissues matrix is more complicated than bacterial culture, which is used in this method and requires extra purification steps. Many methods based on miniaturisation concepts and physicochemical mechanisms have been implemented to achieve chip-scale DNA extraction along with amplification and detection. 0 x10-3ng ml-1fitc. The glass substrate is then used for depositing micro-heaters and micro temperature sensing resistors. 133 156 Figure 4. The photodetector is provided by photodiode nm from 525NM TH, from Opto Diode Corp. 96 119 Table 3. 11 Diagram of rapid PCR cycles focused on three reactions (denaturation, annealing and extension). Finally, we illustrate that the proposed deterministic approach is a general tool and can be applied to other problems in wireless network information theory. The chip was designed to be manufactured via injection moulding, as can be seen in Figure 2. The elongation temperature depends on the DNA-Polymerase. G. As Joseph Conrad pointed out in Heart of Darkness (Conrad, 8), colonization was undertaken for specific motives, the most direct being to... However, all of these methods have not yet replaced PCR because most of these methods are highly expensive and involve complex enzymatic processes in comparison with PCR (Auroux et al, 2004). Since = + Equation 4. The basic genetic material is fundamentally the same in all living organisms: it consists of chain-like molecules of nucleic acids- deoxyribonucleic acid (DNA) in most organisms and ribonucleic acid (RNA) in certain viruses- and is usually associated in a linear arrangement that (in part) constitutes a chromosome. 114 137 Figure 4. The valves and mixers established in this chip were enough to exemplify the completions required to create nucleic acid extraction process in the chip. A mim passou por ana paula sampaio amounts of …Salman Avestimehr is an Associate Professor at the Electrical Engineering Department of University of Southern California. Over the past couple of decades, study of multiuser Gaussian networks has been an active area of research for many scientists. Fluorescence intensity Figure 4. In this work, a miniaturised PCR system comprising a microfluidic PCR chip, novel heating method and fluorescence detection unit was developed. 3). 23 Based on data in Table 4. Ralebitso-Senior, Komang and Dr. The light from the LED uniformly illuminates the detection region from the side of the chip on the chip while the photo-detector detects the fluorescent emission at 90 degree, i. 3. They are the key components of the PCR amplification because they define the region of DNA to be amplified. The lift-off process follows the same process steps as standard photolithography, except after the image has been developed a metal is deposited onto the surface; then the remaining resist is stripped away leaving a metal layer on the areas of the substrate that weren t covered with photoresist (Figure. COC cycloolefincopolymer. In the PCR process, the reaction is restricted to the bulk liquid and a high SVR will be a challenge due to an increased probability of interaction between the biochemical components and the surrounding surfaces. Figure 1. The magnetic beads are bound magnetically to the electrode and are washed to remove any unbound materials and non-hybridized TBR-labelled probes. The commonly used reagent is TBR (Tris-2, 2 bipyridine ruthenium (II) chelate). The advantage of the device is the possibility of using it in locations where a sterile environment is not available. PCR has been the most popular due to its simplicity and low cost. Nucleic acid sequence-based amplification (NASBA) is a primer-dependent technology that can be used for the continuous amplification of nucleic acids in a single mixture at one temperature. 135 158 Figure 4. Ideally, the reaction temperature should change in a linear manner until it reaches a specific step in the PCR and remain constant during the step, as can be seen in the Figure 46 Figure 1. Xix Chapter 1 Introduction Introduction Background Principles of PCR technique Current PCR applications PCR mathematical model PCR amplification process PCR Kinetics PCR reaction and efficiency Introduction Optimisation of PCR reaction PCR primers DNA polymerase enzyme Optimisation of the thermal-cycler condition Rapid thermo-cycling Lab-on-a-Chip Introduction Benefits of creating PCR-on-a-chip Preview of the investigation Project Objectives... 0x10-3 ng ml -1 (10. 20, which in turn pushes the PCR reaction mixture to move around the circular microchannel and to travel through the three temperature zones. Pagliari et al recently demonstrated apromising new light source technology an inherently polarized light source using electro- spun light-emitting-polymer nano-fibres. This prompts the use of learning and teaching materials that are easy to understand given that these children can easily be distracted. 3 Characteristics of the primer set for flavoprotein Fix A of E. PMT photomultiplier tube convert photons to an electrical signal. 8 pg ml -1 or (19. PTFE is polytetrafluoroethylene. The right side of the picture is a diagram represents the detection unit which include the excitation part (the LED lam) and the emission part (the prototype photo-detector). 10 Components of 2x QuantiFast SYBR Green PCR Kit (Promega,UK) Table 6. The plot shows dsdna standards concentrations vs. 0x10-3 ) 0. The necessary steps of cell pre-concentration; cell lyses and nucleic acid concentration are performed by solid phase extraction within a disposable chip. 8. Gloria Anzaldua's great-grandfather, Urbano Sr. The actuated pneumatic pump and microfluidic components in the channels allow for a robust and autonomous sample manipulation as can be seen in Figure 90 Figure 2. The DNA polymerase in this step synthesise the target single strand DNA copy using the pooled dntps as a building blocks. Her guidance helped me in all the time of research and writing of this thesis. Single molecule PCR can easily be performed by PCR microfluidics, starting with a single-copy sequence in the PCR mixture. However, as the cycling speed increased in modern machines which applied advanced technology, such as Peltier technology, the proportion of time spent in temperature transition between the steps decreased and temperature ramping changed, as in Figure Figure 1. The analysis and exploitation of genome sequencing information is mainly depending on PCR results for interpretation. Figure 4. 156 179 5. 2 Schematic diagram shows the prototype thermal-cycler system, which consists of 6 aluminium blocks arranged in three units (representing the three PCR steps: denaturation, annealing and extension). Each heating zone contains a heating element (Farnell, brand Duratool, electric iron power 48 watt), a temperature sensor (Farnell PT100, 2X2. Each unit consists of two aluminium blocks and each block (Depth Width Length) cm. 3 pg ml -1 ) in the in ocean optic spectrophotometer. In addition, a fluorescence detection system was employed for detecting of PCR products using SYBR Green I fluorescent dye. In PCR testing the primer is selected to be complementary to the analytically-relevant sequence of DNA. The elongation of this cycle will produce two double DNA strands identified from both sides by the primers, which mark the target region to be amplified. The prototype photo-detector as illustrated in Figure 4. Ure 3. The highest activity of these enzymes should be present during the last cycles of the reaction process, as the largest amount of template is present at this stage of the PCR process, but the enzyme in this stage is already losing activity, which may lead to enzyme depletion and a considerable decrease in or even lack of yield. All the previous aspects are necessary to design a set of primers, optimize the amplification efficiency and specificity. Abstract = {In communications, the multiuser Gaussian channel model is commonly used to capture fundamental features of a wireless channel. In progress of the proposed design, three formats of double-sides heaters were constructed and tested. Hoffmann-La Roche and Co. 1294), Gene AMP (model No. (2) This model is more practical to scale-down or scale-up the sample size because the sample-chamber can be fabricated according to the requested sample volume. Helen Carney for the continuous support of my PhD study and research, for his patience, motivation, enthusiasm, and immense knowledge. 2 Zou et al. The application of this the crucible research paper photo-detector unit could also be extended for DNA quantization or real time PCR detection. 88 111 According to Figure 3. A polytetrafluoroethylene (PTFE) capillary tube was used to pump the sample around the thermal cycler. Furthermore, decreasing the denaturation and annealing steps should theoretically reduce nonspecific amplification and polymerase inactivation. UK). The proposed design based on constructing three thermal isolated zones to regulate the heat transfer across the sample chamber. We also characterize the multicast capacity of linear finite-field deterministic relay networks when one source is multicasting the same information to multiple destinations, with the help of arbitrary number of relays. Fluorescence intensity. The top PDMS layer is for serpentine-shape (S-shape) pneumatic micro-channels and reaction chambers. 18 Based on data shown in Figure 4. The optimum temperature profile for the models with relatively slow ramping rates i. 1: 131 155 Figure 4. For these systems to become commercialised they need to meet several requirements, including low-cost, easy to use with fast analysis times, and the ability to manipulate small volumes from crude samples. 4pmole) (5. Anzaldua's mother nurtured up on an adjacent estate, Los Vergeles ("the gardens"), which was maintained, by her family, and met and married Urbano Anzaldua when mutually were very young. Thermal-cycler machine. Semi-quantitative tests will detect GM food and compare the results to external reference standards of known GM food concentration, with a detection limit of 0. In summary Figure 1. Polymers could be also classified into three groups according to the position of glass transition temperature (Tg). The detection unit comprises a photo-detector and Light Emitting Diode (LED) as the source of excitation. Moreover, fluorescence detection has commonly been accomplished with microscope-based CCD cameras or other large instruments that systematically inhibit portability In contrast to these larger systems, light emitting diodes (LEDs) have been used as excitation sources, combined with miniaturized detectors such as photodiodes and miniaturised photomultiplier tubes (Banerjee et al, 2010). The 1 carbon of each deoxyribose is substituted with a purine or pyrimidine base. 1, according to a search in Scopus web search, the number of articles describing PCR-on-a-chip significantly increased this decade Year Figure 2. The number of target products are simultaneously increased by the increasing the cycle number (Saiki et al, 1985). Phd dissertation umi ... This foam- 78 101 insulated model also compressed flexibly, squeezing the sample chamber while it was cycled between the blocks, as can be seen Figure 3. Compared to probe-based methods, SYBR Green I assays are relatively easy to design and optimize (Bustin, 2004). 9 The optimum condition of the prototype thermal-cycler obtained to amplifyprimer set Table 5. Consequently, the nucleic acids extraction systems are sufficiently complex without adding the complexity of the analysis systems, such as PCR and a detection unit. 8 Summary of literature review and conclusion All PCR systems comprise of three components: a reaction chamber, a thermal cycler, and a PCR product detector. The optical density (O. 7) The tubes were centrifuged for 5 min at full speed (14000 rpm) to produce three distinct layers within the sample. Migrant Identity in the earlier and later novels by Rushdie In the novel “Midnight’s Children”, Rushdie shows an internal confrontation between national and personal identities. Fluorescence intensity. The experiment was carried out on lower LED power (9 watt) in order to minimise the excitation signal. In particular we demonstrate its application to make progress in two other problems: two-way relay channel and relaying with side information. Each cycle consists of three steps which can be described as the following: 4 27 1) The goal of this stage in PCR process is to breakdown the hydrogen bonds, which connect the double strand DNA (dsdna), in order to provide single-stranded DNA molecules. 2 summarize the similarity and the differences between the proposed design and the other published designs Table 3. The primers are short segments of nucleotides, which complement a region of the DNA to be amplified, i. Detection limit (LOD) is the minimum amount of analyte can be detected or the minimum amount of analyte can produce a significant signal by a system or method. Mullis et al, (1986) discovered that the reciprocal interaction of two oligonucleutides and the DNA polymerase extension synthesise new DNA fragments, when they are hybridised to different strands of DNA template. Greater scatter indicates that more bacteria or other material is present. In particular we demonstrate its application to make progress in two other problems: two-way relay channel and relaying with side information. A selective photodiode detector and a dichroic filter help to detect only the desired wavelength of light. 3. Figure 3. , 2005; Lin et al, 2000), glass (Lagally, Medintz, and Mathies, 2001), polycarbonate (Yang et al, 2002) and polyamide (Giordano et al, 2001 and PMMA (Lee et al, 2004). The method, as described by Mullis et al, (1986) consists of repetitive cycles of denaturation, hybridization and polymerase extension and is known as PCR. This method involves the simultaneous action of three enzymes that produce more than 10 9 copies of DNA under isothermal temperature (41 C) conditions in 90 minutes. In this project a novel thermal-cycler design of double-sides, heaters were investigated. 5x10-4 ) 0. The sample preparation system made of a disposable chip is shown in Figure 2. This is because the hydrogen bonding between G and C bases is stronger than the hydrogen bounding between A and T bases (Harris and Jones, 1997). Fluorescence intensity Figure 4. However, in the continuous-flow model the liquid sample is cycled through a micro-channel and the number of micro-channel cycles represents the number of cycles. PCR is a three-step amplification process first introduced by Mullis and co-workers in 1986 (Mullis et al, 1986) It is a molecular biological method for amplifying DNA without using a living organism. 65 88 Figure 2. Furthermore, quantitative real-time PCR technology has recently reached a level of sensitivity and accuracy also supports its use as a routine bio-technique for gene phase measurement. PCR and its registered trademarks are the property of F. 72 Chapter 3 Thermal-cycler and chip fabrication Introduction Materials and methods Temperature profile measurements Thermal-cyclers temperature profile measurements v 7 3. Optimising the constituents concentration is essential to achieve the best amplification because inappropriate concentration could inhibit the reaction (McPherson and Moller, 2006). During denaturation step at 95 C, double stranded DNA melts open to single stranded DNA, and the enzymatic extension from the previous cycle (72 C) is reduced to a minimum. The basic photolithographic process is shown in Figure 2. Fluorescence results from the absorption of light energy by fluorophore molecule at a specific wavelength and re-emitted at longer wavelength and lower energy. The removal mechanisms of the polymer are dependent on the radiation wavelength used. As can be seen during each PCR cycle, each reaction step occurs at certain temperature over a certain time span. This does not require unequal material provisions. Fluorescence intensity Figure 5. 8 pmole) (7. Dsdna standards for calibration curve and the mean of the photo-detector output obtained from these standards xvii 19 Table 4. Samples with various concentrations of FITC dye were injected in a prototype polycarbonate reaction chamber in a thickness of 1 mm and a calibration curve was constructed giving the correlation between the concentration of the sample and the resulting photo-detector signal. The primers contain a sequence that signals the polymerase to begin replicating DNA at that location. 3 lm at 460 nm to a typical of 20 lm at 480 nm due to this effect. Also there is a variation between wells in the same instrument. The results obtained are demonstrated in the graph. The total time for the PCR test in this work was accomplished in 55 min and the total sample volume consumed was 15 μ. This result is a natural generalization of the celebrated max-flow min-cut theorem for wireline networks. This process has a detrimental effect on PCR performance because binding of PCR components to the surface will alter the optimized concentrations of the PCR components. 2. -The sample is shuttled inside a micro-channel by pneumatic actuation system. For this reason, fluorescence is widely used in many applications, such as: immunodiagnostics, optical microscopy, chromatography, electrophoresis, real time PCR and DNA sequencing. A Dichroic filter, an LED excitation source, and a photo-detector detector completed the detection unit. (2001) investigates the effect of thermal cyclers on PCR performance. D) was then measured with a bench top spectrophotometer (Pharmacia-LKB Ultrospet III) at 600 nm Genomic DNA Extraction and Purity Testing The E. 129 152 4. Pumps, valves, filters and mixers) and analytical separation and detection techniques (e. Figure 3. (b) The design of substrate with three channels represents three PCR-zones. This signal is proportional to the concentration of amplified nucleic acid as can be seen Figure 4. This result is a natural generalization of the celebrated max-flow min-cut theorem for wireline networks. It has 4 mm holes in diameter punched through on the stage to form either one well or four wells for holding the reagents. 6) After the 10 minute incubation time at 65 C the tubes were removed and the lids were opened 680 µl isoamyl alcohol: chloroform (BDH, AR) (1: 24) were then added and the tubes were shaken well to form an emulsion but do not vortex. 26 and Table 4. 5 Integrating system for nucleic acid analysis on-a-chip The achievement of a fully integrated system for nucleic acids analysis is the vision of many micro-total analysis system (µtas) researchers. A. G. Simon Bateson, for their encouragement, insightful comments, and challenging questions. At this temperature, however, DNA-Polymerase was destroyed so that the enzyme had to be reloaded after the heating stage of each cycle. 138 162 Figure 4. Vi List of Tables... The distance between the fibre optic connector and the surface of the chip is fixed at 2 mm; this is to ensure easy access to the chips for the measurements and to minimise the interference of the excitation rays. This temperature is over the transition temperature of polycarbonate (148 C) and the pressure is enough to increase bonding strength and conserve the structure of the chip. 64 87 The light source and spectrometer are employed to provide excitation and fluorescence spectral dispersion for DNA binding dye detection (SYBR Green1). The sample is placed in circular micro-channel and travelled through three temperature zones by an external magnet, which was used to drive a small ferrofluid plug inside the circular micro-channel. They are composed of two layers of thin glass (0. From the surface of the chip. Actuation and heating is done externally so that the chip can be kept as simple as possible. However, the primers are not only annealed to the new DNA strand but also to the original DNA template and this generates double strands DNA elongated by primers on one side. The background signal in chemiluminescence detection is extremely low, but the generated signal is also very low, compared with fluorescence signals (Hatakeyama et al, 2009). This step can be done by holding the tubes in the float and inverting the float which therefore mixes all of the tubes at once. The conventional nucleic acid extraction protocols generally include processes such as sample filtration, centrifugation, dilution and extraction. The researchers suggested a cleaning step prior to use. 4 Therefore, the total fluorescence intensity is proportional to the concentration of the chemical compound in the specific sample chamber. The fluorophore in free buffer solutions, such as SYBR Green 1, displays relatively low fluorescence but when bound to dsdna its fluorescence increases over fold (Bustin, 2004). Stray excitation rays are reduced by means of the dichroic filter, which is situated on the top face of the reaction chamber. 1 Where (X) is the main efficiency per cycle, (n) is the number of cycles and (Y) is the yield of amplification. 5x10-3 ) 6. Table 3. However, none of the designs produced could be efficient for all kinds of samples. 2 Thermal-cycler temperature profile Thermal cyclers are the programmable heating blocks that control and maintain the temperature of the sample through three temperature-dependent stages that constitute the single cycle of PCR: template denaturation (95 C); primer annealing (50 65 C); and primer extension (72 C). The deoxynucleoside monophosphate to be incorporated is chosen through its geometric fit with the template base to form a Watson-Crick base pair (A-T and G-C) see Figure 29 Figure 1. The difference in the light wavelength between the absorption and emission is termed the Stokes shift. In this system, the background was measured by injecting a PBS buffer ph 7. 5). 64 pmole) (1. 2. For example, even the capacity of a three node Gaussian relay network, in which a point to point communication is assisted by one helper (relay), has been open for more than 30 years. Therefore, miniaturising the nucleic acid extraction step is the most difficult part of the entire DNA analysis process on- a-chip-scale. 3. Both Progene and Gene AMP use one block heated and cooled to reach the PCR temperature step. 064(64 pmole) (5. 3 to establish the LOD detection graph shown in Figure Table 4. Edel et al, (2004) demonstrated the use of a poly fluorine based LED (polymer LED) as light source, an avalanche photodiode as a detector with limit of detection(lod) of 1 mm for fluorescein dye. This translates into 500 µm spot size at the entrance and exit of the optic fibre. This technique works on the basis of using intense UV or infra-red radiation from a laser in order to remove the polymer. This cycle requires, 1-2 minutes in conventional thermal cyclers. PCR chips have been made by various materials such as silicon (Nagai et al. The resulting issues are loss of a sample on the walls of transferring devices, loss by evaporation, loss of components from the sample during manipulation, possible loss of a sample resulting from the immediate contact of the PCR solution with chamber walls (Ji et al, 2007) Chamber-based PCR chips are constructed as closed systems where the reaction Chamber (s) is actually microfabricated on the chip. However, not all agree to the use of these novels in educating children and think that they might have negative... 1. }. The low concentration solutions were incorporated with the standard solutions in Table 4. The substrate and photoresist are then exposed to UV light through a photomask which contains the desired pattern, which is to be transferred (B). As a result, although the detection system will sometimes detect smaller concentrations of that analyte than the LOD, the LOD represents the smallest concentration that indicates the true detection proficiency of the system (Vogel's 2000). 19 Table 2. When the polymer has hardened, it can then be removed from the mould (Geschke et al, 2004). E. 2 PCR Primers Background Information Three different sets of primers were used in PCR tests. 8) The top aqueous layer removed and transferred into new clean Eppendorf tubes. If the DNA template is rich in G and C bases, it would require higher temperatures than those having a balanced mix of bases. This classification is more likely to define the feasibility of the microfabrication process: 1) Thermoset: it is a kind of resinous material used commercially in liquid or solid form (at room temperature) and can be activated by a process called curing. (A) A diagram shows effect of the shape of the microchamber on the loading of the PCR solution, where the black portion indicates the area filled with PCR solution. The following experiments will be focused on defining the sensitivity of the system and the investigation of the unit for PCR detection. The enzymes start the 7 30 copying process all over again, doubling the number of DNA copies with each pass. The advantages of the electrochemical detection over the optical techniques include not only the inherent miniaturisation and portability, but also independence from the optical path length, sample turbidity, extremely lowcost, low-power requirements and compatibility with micro fabrication (Fang et al, 2009). 5) ng ml -1 (0-1. D represent denaturation zone, A represent annealing zone and E represent extension zone (Chung et al, 2010). PCR works by binding to a single DNA strand and creating the complementary strand. Satirical graphic novels, among other graphic novels, have an aspect of encouraging the reader to keep on reading so as to grasp the intended meaning. Start Your Doctoral Degree Now. However, the results of temperature performance tests for several brands of thermal cyclers show that most cyclers do not perform within the manufacturers` specifications (Xiang, Xu, and Li, 2007). The analysis methods of the amplified PCR products include gel electrophoresis (Obeid et al, 2003; Lin et al, 2000; Lee et al, 2004). The temperature rose from 60 C to 72 C and from 72 C to 92 C in the rate of 129 Temperature ( C) MINIATURISED SYSTEM FOR DNA ANALYSIS 2012 degree per second Figure Consequently, initial denaturation stage required at least 2 minutes to ensure complete denaturation of dsdna and adding10 seconds in each step would be enough for the PCR mixture to attain the desire temperature. The device is a model of miniaturized PCR system for amplifying RNA-based molecules such as RNA virus or mrna. The amplification technique applied is NASBA (Nucleic Acid Sequence Based Amplification) and subsequent fluorescence detection is readily integrated into a chip format. However, special care must be taken in the thermal design of a chamber array in order to obtain temperature uniformity between chambers. TeesRep: Teesside University's Research Repository 2 MINIATURISED SYSTEM FOR DNA ANALYSIS ABBAS ALI SALMAN Doctor of Philosophy (PhD) Teesside University January 2013 This research project was carried out within the Nanotechnology group at Teesside University. Over the past couple of decades, study of multiuser Gaussian networks has been an active area of research for many scientists. MRSA Methicillin-resistant Staphylococcus aureus is a bacterium that causes infections in different parts of the body. E. The R 2 value of the plot is and the plot equation as indicated in the graph. Fabrication of these small components and networks has been mastered Figure 1. Moreover, the heaters are double plates in order to sandwich the sample chamber, as will be discussed in chapter three of this thesis. 6, body was made from silicon wafer with a thickness of 680 µm sandwiched between Pyrex cover and PC film with a thickness of 100 mm. More details were discussed in the introduction of the thesis. Iii 5 TABLE OF CONTENTS List of Figures... , paired nucleotide units that code for a protein to be produced by a cell's machinery, such as its ribosome s) are constructed. The measurements were taken using HR4000 ocean optic spectrometer; it is clear that there is a significant signal development at wavelength 523 nm. The interface gives the user full control of the sensitivity of the detector. 3. The tested prototype photodetector was suitable for the development of portable, robust, and detection device. AG, Basel, Switzerland. A blue-light LED is employed as the excitation light source, with a peak emission at a wave length of 470 nm. PDMS are used to produce a microfluidic control module that operates the movement of individual membranes to realize micro pumps and micro valves with which to control the fluid flow within the device. The detection system was implemented with a fibre optic to collect the fluorescence signal, which was directly aligned onto the microfluidic reaction chamber. E. As the target is amplified, the increasing concentration of double stranded DNA in the solution can be directly measured by the increase in the fluorescence signal (Figure 4. The deposition of metals is a very useful and important step in the photolithography lift-off technique. 8 The optimum condition of the prototype thermal-cycler obtained to amplify primer set Table 5. 4 The graph shows the ideal progress of real time PCR detection expressed by fluorescence data when fluorophore was used. For example, let us consider relationships between Aadam Aziz and his future wife Naseem. 4. Figure 2. The silicon wafer was bonded with the glass substrate using an anodic bonding technique. 10, the thermistor temperature measurements were improved in agreement with the thermometer temperature measurements in most of the measured readings. 3. The background level is defined as the concentration above which the decision detected is made. Typically, an initial denaturation is carried out at 94 C for 5 minutes and the denaturation step at 94 C for 45 seconds. Typically, an experiment is done by exciting the light at a fixed frequency (from an oscillator or function generator) and the lock-in detects the response from the experiment at the reference frequency (Dorrington and Künnemeyer, 2002). The LOD obtained was 103 ng ml -1. In Mullis's original PCR process, the enzyme was used in vitro. It is made of two polydimethylsiloxane (PDMS) layers and a glass substrate. The fluorescence intensity of the FITC solution in the chip-reaction chamber was monitored over different experimental setups before defining the described setup. 5 mm 15 mm and 10 ml sample volume was fabricated using silicon, glass, polycarbonate film, and double-coated tape. The aluminium chamber as can be seen in Figure 3. The fabricated chip, which includes the sample chamber, was used to perform thermal cycling. Once the polymer and dye have reached the desired temperature, the dye is then pressed into the polymer with a controlled force, (typically in the order of several Kilo-Newtons (KN)) for several seconds, and then cooled to below the glass transition temperature. The mechanism of the process is an enzyme polymerisation reaction. The plot illustrates the DNA concentrations vs. Subsequently accomplishing a... 2x10-3 (3. 5 A schematic diagram illustrating the experimental setup to measure the fluorescence intensity in the prototype chip. 4 for the all measured points. The calibration curve obtained is shown in Figure The linearity of the curve in accepted limit as the correlation coefficient is (R 2 ) is The results deduced are that, experimentally, the lower concentration (LOD) of FITC detected was 1. (2001) and Matsubara et al. For calibration, the thermistor was placed in the water bath at room temperature along with the two thermometers. Each cycle of PCR can be completed in 60 second (10 sec denature, 20 sec anneal, 30 sec extend). There are a wide range of applications for these lab-on-a-chip and μtas devices, such as point of care diagnostics, chemical analysis, environmental monitoring, and forensic testing. The PC slide contained a pattern of wells and channel Figure 3. At temperature 100 C the measurements were stopped and a graph of measurements was sketched, as shown in Figure 3. In addition, microscope-based charge-coupled-device (CCD) cameras or other optical sensing instruments were used to accomplish the fluorescence detections. (A) Layout of PCR card with thermocouples. First, Mark criticizes Paul Gilroy’s work, which deals with opening a transfigurative and utopian vision of a modified world... Rushdie draws parallels between split identities of Indians who have no exact place of residence when different national borders are blurred and “hybrid” identities of the Westerners. The elements of mystery, realism, and fairy tale have been weaved together to create a plot of family tension term papers on global warming and crisis during the 1954 Australian Cold War narrated by the main character Matilda, who’s’ childhood simplicity shapes the course of the story. Details of fabricating materials are also incorporated Table 2. This step is called elongation. However, in the prototype-photo-detector the LOD evaluated was ng ml -1 (7. The structure also illustrates that as one strand follows the sequence down the left-hand strand (C to T), the corresponding strand is also following the carbons of the deoxyribose ring, going from the 5 carbon to the 3 carbon. The amount of light scatter can be measured in a spectrophotometer at wavelength of 600 nm (OD 600 ). The blue LED used was type LUMILEDS - LXHL-NB98 Farnell -UK) 2) Fluorescence The setup implemented for fluorescence was an orthogonal setup, as can be seen in the Figure 4. However, the photo-detector system has successfully secured a LOD of 19. The code is made up of subunits, called nucleic acids. Furthermore, there is a requirement for portability, integrity of the PCR device with a detection unit and acceptable disposal of the PCR reaction vessel. As can be seen from the black display, the lower significant signal was above the concentration of 1. The difference between this model and the continuous-flow model is that in this model the liquid sample or sample chamber is circulated between the three constant temperature zones for a predetermined number of cycles (e. Take The Next Step In Your Career. As can be seen the significant amplification is started at the threshold point and then the exponential phase proceeding until plateau phase, which indicate the enzyme exploding in this phase of process. To avoid measuring the incident light, the fluorescence emission was measured at right angles to the incident beam, as illustrated in Figure Figure 4. The first cycle, the dntps incorporate beyond the sequence complementary to the primer to form undefined DNA fragments, see Figure 1. Info, 2010). There are three major issues in the hot embossing process: the filling of structures by the polymer, reproduction fidelity, and master separation during de-embossing (Franssila, 2004). 15 mm glass with a layer of PDMS in between, as shown in Figure 83 Figure 2. The temperature inside the reaction chamber were measured using a sensing probe, ultra thin high tolerance thermister (Rapid Electronics) and data were collected by data-logger (Pico Technology ADC-24). After cooling, the dye and the polymer were separated, leaving the desired pattern in the polymer substrate. 18 Fluorescence signal of the chip contains the PCR mix along with SYBR Green after the sample had been amplified in the device. The fluorescence analysis can be quantified by defining the amount of energy falling upon a defined area (measured in square metre m 2 ) within a defined wavelength region, which can be measured in nano-meter (nm) (Bustin, 2004). This value of LOD is near the theoretical LOD estimated in plots Figure 4. 2 and the calibration graph shown in Figure Table 4. However, the HR 4000 ocean optic spectrometer fluorescence measurements, which had been carried out using the prototype microfluidic chip, presented LOD of 1. Nucleic acid sequence base amplification (NASBA) was first initiated in 1991 by J. The best three different temperature ranges were at 50 ºC, 70 ºC and 90 ºC, then the equation was developed and the calibration achieved is illustrated in Figure 3. As mentioned before, the reaction chamber substrate is made from 1 mm transparency polycarbonate. The optimum annealing temperature (T a ) depends upon the primer s melt temperature (T m ), which eventually depends upon the base sequence of the primers. The on-line fluorescence detection system is shown in Figure 94 Figure 2. To make further progress, we present a linear finite-field deterministic channel model which is analytically simpler than the Gaussian model but still captures two key wireless channels: broadcast and superposition. 11 Comparison graphs obtained from the study of the different types of thermal cyclers. 2 ml Eppendorf PCR tube. Fluorescence write block essay scan after PCR test were used by Matsubara et al. 4 Proof of Concept Demonstration Geometric Placement of the Detector To excite the molecules in the sample chamber, an LED is used to excite the light at 480 nm. 17 Schematic diagram of the proposed chip made from polycarbonate sheet of 1. 2 This figure described the basic Photolithographic Processes steps. This step takes much longer than the other two and the dwell time depends on the temperature, concentration, and the length of the target DNA segments. In addition, handling and processing of small sample volumes in the case of the increasing number of PCR reaction chambers on a single chip create some potential challenges. Giese et al, (2009) demonstrated a short tandem repeat (STR) PCR amplification system, which can be used for forensic analysis. 109 132 Chapter 4 Detection system 4. 3 mm 2 and it was made from polycarbonate film in a thickness of 127 µm to allow access of fluorescence detection. 5 of fluorescence intensity obtained from the photodetector, a plot of DNA standards concentrations vs. 6 Summery of statistical analysis of DNA calibration in the chip for the measurements performed on different fluorescence detectors, the table also shows comparison of LOD in different systems Table 4. 0 degree per second. Then they were rinsed by distilled water before being sonicated in distilled water for 10 minutes to remove any decon 90 residues, which inhibit bonding. 4 The optimum reaction mixture of 25 µl reaction used to run the PCR for universal primer for primer set Table 5. The measurements were taken by the prototype photo-detector. The easiest way to do this is to hold the tube at an angle and draw the aqueous layer into the tip slowly and gently. As can be seen from the black display, the lower significant signal was above the concentration of 1. 3 millimetre. The temperature increased from ~47 C to ~92 C in the rate of 1. Mole is the amount of chemical substance that contained molecule of the substance. This model is the most practical miniaturised PCR for three reasons. Therefore, decreasing the heat competence of the cycling system can clearly decrease the total time required for PCR. The wavelength and the amount of light absorbed and emitted are known as the fluorescence signature. This experiment was performed to test the ability of the prototype device for use with differing sized amplicons across a range of 250 bp to 1500 bp. Yao et al, (2005) fabricated a microfluidic device with an integrated OLED excitation source and a PMT as detector for on-chip fluorescence detection using a pinhole and interference filter for masking the excitation light. Other parameters can be controlled in the programme as chart length. The applications include: production of small devices for catheter tips, single cell diagnostics, combined drug delivery and monitoring devices, synthetics of replaced organs (e. 47 71 chip includes zigzag mixers to mix reagents, fluid reservoirs to allow different fluid velocities through various regions of the chip, a PCR chamber and an optical detection well for an end-point fluorescence measurement. PEEK polyetheretherketone. (an emulsion is achieved when the tube contents turn completely white and milky). Polysaccharides and proteins. 3000). The optimum extension temperature is 72 C, which seems to be suitable for most applications. The heating and cooling rate of the system slowed the reaction process, as the block needed time to reach the target temperature, as in (GeneAMP), whereas the models of fast ramping rates in the Rotorgene model tended to produce overshooting Figure 118 Figure 3. When an infrared laser is used the irradiated material is heated and decomposes; when UV radiation is used the irradiated polymer decomposes by a combination of thermal (caused by heat) and direct bond breaking caused by direct absorption of UV photons (Geschke et al, 2004). The quality of the DNA was tested in the laboratory to ascertain the quality. Theoretically, the number of templates should double after each cycle. However, a substantial challenge still prevents the production of one. It is the growing end of the DNA chain and it simply provides a free 3'- OH end at which the enzyme DNA polymerase adds on deoxyribonucleotides units (monomers). A formation of self-identity of Rushdie’s characters occurred under the influence of their inner worlds, political and social history, and cultural background of their countries. The electronic parts are as described in Figure 3. 9 Ω flexible silicon Kapton resistive heating element in contact with an aluminium plate on the opposite side of which a thermal conductive silicon pad was mounted, as can be seen in Figure. The primers sets used were as follows: PCR primer set 1 (250), PCR primer set 2 (512) and PCR primer set 3 (1500), Table 5. The LOD is mathematically expressed as a concentration and will be derived from the fluorescence signal generated by the photo-detector, which converts optical power into a voltage signal. The smaller glass cover is placed onto the chip to seal PCR reagent (Xiang, Xu and Li, 2007). The main factors controlling the temperature ramping rate, according to the heat transfer law, are chamber size, surface area and a thermal conductivity of the chamber materials The heat conduction transfer rate per unit area is proportional to the normal temperature gradient: q dt A dx Equation 3. 7 This picture shows the photo-detector interface in the display. 2 The left side of the picture illustrates the chemical structure SYBR Green 1 (Draw using ISIS software). (2005) reported a single-well PCR chip and a multiple-well PCR chip. The second reason is related to the mechanism of heat transfer because the sample in the light chamber possesses an elevated ramping rate for heating and cooling. 2. I 3 ABSTRACT The growing markets for analytical techniques in areas such as pathogen detection, clinical analysis, forensic investigation, environmental analysis and food analysis require the development of devices with simultaneous high performance, speed, simplicity and low cost. In regards to commercially available thermal-cyclers, the study carried out by Young et al. 5) The tubes were placed in the 65 C water bath for 10 minutes. The signals processing was designed, an initial test of the fluorescence detection capability. This information can be used to quantify initial copy number based on threshold cycle (Ct) i. 2 The FITC concentrations were prepared for LOD detection experimentally in the chip system for Ocean optic spectrophotometer. , formerly a precinct magistrate in Hidalgo County, remained the chief proprietor of the Jesus Maria Ranch on which Anzaldua was born. 89 112 3. 1 Schematic diagram describing the suggested development in chip design List of Tables Table 1. 8pg ml -1 (19. 2x10-3 ) (32 pmole) (2. 1. Serial low concentrations of FITC were prepared and fluorescence measurements were taken using the chip. The PDMS is a 0. After amplification, the PCR products are hybridized to oligonucleotide probes containing the electrochemiluminescencent label. Fabricated reaction silicon chambers are inserted into a pressure-fit electrical control holder to control a thermal cycler heater. Kim et al, (2006) demonstrated a compact device using an OLED as light source and an integrated photodiode as detector, with an interference filter to mask the excitation light and secured a LOD of10 mm of TAMRA dye. In this work, the nonpathogenic E. When used with reference to molecular dimensions, it is a macromolecular pattern for the synthesis of another macromolecule. In double-stranded DNA, bases face each other in the center of the molecule and base-pair via hydrogen bonds (dotted lines). Partners. 25 Based on data in Figure 4. (2008) on different types of thermal-cyclers shows that a majority of the tested conventional PCR instruments having a significant curving and overshooting in their temperature profiles, which substantially influenced the results of the temperaturesensitive multiplex PCR. This experiment is also important to demonstrate the prototype device application. 257(257 pmole) (15x10-3 ) 0. Zulfiqur Ali and Dr. Both static chamber-chips (Lin et al, 2000; Giordano et al, 2001; Nagai et al, 2001; Lagally et al, 2001; Yang et al, 2002; Lee et al, 2003) and continuous-flow PCR chips (Kopp, De Mello, and Manz 1998; Obeid et al, 2003; Hashimoto et al, 2004; Liu, Enzelberger, and Quake, 2002) had been reported. From the surface of the chip Optimisation of Fluorescence Detection: Limit of Detection using FITC Finally, the photo-detector component is used and its performance is characterized in a proof-of-concept demonstration setup. 12 by micro-fabrication techniques adapted from semi conductor and plastics industries, such as photolithography, micromachining, replica moulding, hot embossing and injection moulding. If the primers do not match any of the DNA in the sample, the DNA will not be replicated. Teesside University This document was downloaded from All items in TeesRep are protected by copyright, with all rights reserved, unless otherwise indicated. 6 volumes of isopropanol (BDH, AR) (360 µl. 16 (a) Emission peaks of different concentrations of FITC in the range (0 to 0. The primers were selected to produce three different target sizes. The PDMS is a 0. For example, even the capacity of a three node Gaussian relay network, in which a point to point communication is assisted by one helper (relay), has been open for more than 30 years. If the target region is, for example, less than a 100 base pairs, no holding time is necessary to accomplish an efficient PCR reaction (Wittwer et al, 1990). The fluorescence signals in the first experiments were measured using HR 4000 ocean optic spectrometer and on the prototype photo-detector, the fluorescence signals obtained on ocean optic are shown in Figure Calibration plots were constructed and regression analysis was carried out to estimate the LOD. The time consumption for amplification is low and the temperature-increased rate is 1. The pathogen detection system focused mainly on the detection of the pathogen genome. Temperature data was recorded every one second for 1200 second using the data logger. One injection will avoid the requirement to perform multiple transfers of liquid to assemble a PCR mix. In addition to the data acquisition unit to control the whole device process (PC). 28 nm) was then used to prepare serial working standard solutions listed in Table 4. This system can realize high-throughput PCR amplification, due to the significant features as follows: 53 77 sheets of thickness (3 mm) insulating sheets were used to separates the three temperature zones from each other. However, the excitation signal is eliminated after a dichroic filter is employed. The excitation light, with a wavelength of salman avestimehr phd thesis 480 nm, is directly brought to the reaction chamber, which is placed as close as possible to the excitation unit. 385(385 pmole) The fluorescence peak maximum was estimated for each concentration using HR4000 ocean optic spectrometer, as can be seen in Figure Then a calibration curve was plotted Figure Good linearity was observed with R 2 = Figure 4. 7A and Figure 2. 1 this table summarizes the physical and chemical properties of commonly used polymers in addition to the current applications in biotechnology and medical field Table 2. The optimum annealing temperature depends upon the melt temperature and the base sequence of each primer. 1 A summary of the nucleotide sequences of the oligonucleotides used and their target genes. Both methods require a special thermocycler equipped with a sensitive camera that monitors the fluorescence in each well at frequent intervals during the PCR Reaction (Bustin, 2004). The area of µtas has rapidly grown during the last decade and there has been a steady expansion in the number of publications associated with this research field. The cleaning step suggested was as follows: the glass-chip should be exposed to a 1:1 methanol: hydrochloric acid (HCl) solution for 30 min, rinsed with distilled water, and exposed to concentrated sulphuric acid (H 2 SO 4 ) for 30 min. 7 pmol) of FITC. Banerjee et al, (2010) had been able to successfully measure Rhodamine 6G down to 10 nm by means of a thin microfluidic chamber that used organic devices both as optical sources (organic light emitting device) and detectors (organic photodiode). A middle dilution of 0. In the micro temperature control system, the heating and temperature sensing elements are fabricated of the same material platinum (Pt) and are located within the reaction chambers to ensure a uniform temperature distribution, low power consumption and high heating and temperature sensing rates as can be seen in Figure This system is capable of providing a rapid and precise temperature control. In the convection PCR devices, PCR samples are shunted and circulated using the buoyant force (called thermosiphon effect) generated by the thermal energy of the PCR reaction itself. 12 The picture summarises the concept of Lab-on-a-chip which is intended to scale down the all the laboratory activities in one chip. As this DNA molecule typically consists of millions of base pairs, the amplification process targets only a specific part of this template; then after one cycle of PCR amplification, the process generates two new DNA strands initiated from the primers, in addition to the original dsdna template (Figure. (C) Layout of top plate. 2) Light Source Focus: excitation intensity will increase with optimized focus of the position of the LED lamp. 2 PCR Master Mix constituents were used for primer set Table 5. ) and mixed carefully by gently inverting the tubes. Fluorescence detection has been reported, using of miniaturised excitation and emission sources for microchip devices. 25x10-3 ) 3. Chung, Park, and Choi (2010) proposed impressive convection-based PCR systems see Figure The system proposed consists of triangular closed-loop disposable polymer channels, a heating block unit and a temperature controller. The PCR system must be designed carefully and applied only after correct validation at the desired temperatures. Xxi 25 Figure 1. 3) Elastomers: the molecular chains are in this class of polymer typically do not show a chemical interaction but are physically entangled. Avestimehr phd thesis: Salman avestimehr phd thesis. The six blocks were ordered from left to right to accomplish the three PCR thermal cycler periods; denaturising, annealing and extension phases. Tybalt essay electrical engineering computer science both. 2 Where represents the intensity of light absorption and (Фf) is the quantum efficiency of the fluorophore compound. Ox10-3 ng ml -1 ) as can be seen in Table 4. This process occur at time between (1-1 0x10-8 second) and is called fluorophore lifetime. The thermometer was connected with a relay switch to control the temperature in the blocks. Without a DNA primer sequence a new DNA chain cannot form since DNA polymerase is not able to initiate DNA chains. Fery et al, (2007) described a shunting design of a polymer-based, multichannel device for PCR. For example, single strand displacement amplification (SSDA) is an isothermal technique first introduced by Walker et al, in (1992) This method allows exponential amplification of double-stranded DNA. They produced a close-loop circular ferrofluid driven microchip for rapid PCR. POC point of care. However, it expends only ~5 seconds to rise from ~72 C to~ 92 C. The chromosomal DNA used in this work was extracted from non-pathogenic K-12 subtype of Escherichia coli (E. The fluorescence probe is used to monitor the reaction and each amplified strand causes a fluorescence probe to increase its fluorescence output. Robustness. It includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). They measured inter-block reproducibility and intra-block repeatability showed that temperature-calibrated instruments consistently generated more repeatable rapid data than non calibrated instruments, regardless of the make and model of a thermal cycler. 193(193 pmole) (10x10-3 ) 0. Base Pair (bp): Two nucleotides that are in different nucleic acid chains and whose bases pair (interact) by hydrogen bonding. Compton. Then, the temperature controller of the water bath was raised to 100 C and left steadily elevated. 9 32 In this chapter, the mathematical model of the PCR process will be described, in order to define the major factors which govern the efficiency, the specificity and quality of PCR as an analytical technique. Cancer research has already 8 31 been implemented in real time PCR analysis and others are being validated, showing that this molecular biology tool can provide both researchers and clinicians with valuable information concerning the behaviour of tumours. A spectrometer (HR4000, ocean optics, USA) was used as control spectrometer to evaluate the efficiency of the prototype photo-detector. There are two main problems associated with using the thin films, namely, disclosing the chambers and sample accommodation. The technique depends upon the incubation of a suitable fluorophore compound in a PCR reaction mixture that was cycled between three temperatures. It starts at the annealed primer and works its way along the DNA strands. Consulting editing writing, phd thesis khan bas karatli sehit sahin. The number of cycles required for best possible amplification depends upon two main factors: the initial concentration of the PCR constituents and the efficiency of each amplification step. Deposition techniques allow for materials, such as metals, to be deposited onto the surface of the substrate; this can be done instead of or after the etching process. 4 Schematic diagram of the device in final form. A. Since the year 1993, many miniaturisation methods have been investigated and many miniaturising techniques have been applied. In order to integrate PCR system 68 92 μm pinhole, spectrally filtered by a 515-nm band-pass dichroic filter (30-nm band width), and detected by a photomultiplier. The PCR reactor was experimentally characterized by using thin thermistor. The LED lamp was fixed inside an aluminium cavity and the beam path is defined through a 2 mm diameter tube from the side of the cavity. AS can be seen in (a) g is the gravitational acceleration area. 42 ng µl -1 (142 ng ml -1 ). It is important that both primers have similar annealing temperatures. 31 ng µl -1 (131 ng ml -1 ). Concentration in ng ml -1 Concentration in nm(10-9 M) (1. The incoming light is propagated through the 1 mm side of the reaction chamber at the position of the centre of the reaction chamber. IDT Inter-Digital Transducer or Piezoacoustic IDT are a key component of SAWdevices, which are used for measurement of material properties and signal processing. After hybridization, the reaction mixture is mixed with streptavidine-coated magnetic beads that bind the biotin-labeled hybrids. In this system, a pneumatic micro-pump is adopted to precisely drive the sample flowing through three reaction chambers. Lee et al, (2006) demonstrated a rapid DNA extraction and real-time detection of pathogens in a single chamber of a microchip within 32 minutes without channels, pumps or valves. This test was repeated three times and in each attempt, the thermistor equation was changed according to values obtained from appropriate temperature ranges. As such, it is automatically aligned with the rest of the system. Coli K Table 5. The bonding steps are lustrated in the schematic chart Figure 124 3. 2). 5. The sample loading failed for certain chamber geometries. Three constant heaters allocated for three temperature zones. As, the PCR mixture is flow through the three temperature zones required to complete PCR amplification. All measurements unit used in millimetres (mm). Finally, we illustrate that the proposed deterministic approach is a general tool and can be applied to other problems in wireless network information theory. 17 A photograph of 16 lane microfluidic bio-chip designed by Giese et al, (2009); each lane volume is 7 µl of PCR sample Model three shunting PCR system This model of miniaturised PCR combines the advantages of the previous models as the sample chamber is transferred back and forth along three different temperature zones. 37 60 2. The measured inter block reproducibility and intra block repeatability shows that temperature-calibrated instruments consistently 90 114 Figure 3. Xvi phd thesis electronics Glossary... The test was carried out on the thermistor before being used in the temperature profile measurements. However, this system is different as the sample handling technique utilizes a pneumatic actuation system to move the sample over the three zones. (3) Multiplication of a simple disposable polymer sample-chamber is more affordable than producing more complicated chambers, such as the model that includes a heater or a model that replaces the capillary tube, as in the continues-flow model. Key words: PCR shunting system, Portable PCR device, DNA analysis, Minturization, lab-on-a-chip. 05 µg ml -1 or ( nm). 82 110 3. 1 The column chart shows the number of articles describing microfluidic PCR systems from the year 1993 until the year The chart shows the developing in the number of publications after year 55 cross-linked polymer chains. These kinds of polymers are commercially available in the form of ready to use sheets, rods, tubing and films. In comparison of this system with number of investigators work, there has been many attempted to integrate fluorescence detection with microfluidic chips. 127 mm) sandwiched a polycarbonate slide, thickness 1000 µm (1 mm). 9. Each nucleotide consists of one nitrogen base, one deoxyribose sugar and one phosphate molecule. The chip, as can be seen in Figure 2. He received his Ph. The amplification methodology involves the use of three enzymes, reverse transcriptase, T7 RNA polymerase, and RNase H; and the final amplification product is single-stranded RNA with a polarity opposite that of the target. Polyimide also belongs to this class of polymer and could be cured by heating the polymer above 300 C. LOD Lower Detection limit ADC Analog-to-Digital Converter Thermistor is a type of resistor whose resistance varies significantly with temperature, more so than in standard resistors ISO International Organization for Standardization AutoCAD is an industrial leader in 2D and 3D CAD design used for drafting, modeling, architectural drawing, and engineering software. The structures of primers are copied from the original DNA template. Chromosomes: Discrete units of the genome carrying many genes, consisting of (histone) proteins and a very long molecule of DNA. 5, meaning that the direction in which fluorescence is collected and the direction of the light path of the excitation are perpendicular to each other. These factors makes SYBR Green I a common choice for optimizing. However, from the second cycle, both primers (forward and reverse primer) flank the elongation and after that, the process exponentially increased to accumulate the target products (Harris and Jones, 1997). 2 A summary of the S. Found in the nucleus of every plant and animal cell. Each block contained a heating element (Farnell, brand Duratool, electric iron power of 48 watt) and a platinum resistance thermometer type (PT100, from Farnell). Although the luminous power efficiency is lower in the short blue wavelength range, radiometric power efficiency increases as wavelength decreases. 20 Schematic drawing of the PCR microchip with heating blocks and magnetic source (Sun, Kwok, and Nguyen, 2007). The PCR chip is composed of two layers of 0. The primers were purchased from Sigma Aldrich, (UK). 31 iv 6 2. The volume of the sample is 28. Comparative temperature measurements between two calibrated thermometers and the thermistor reading were made at the same time in identical conditions. These temperatures are cycled up to 40 times to obtain amplification of the DNA target (Zhang and Xing, 2007). 4, to achieve consecutive three PCR thermal cycler periods; denaturising, annealing and extension phases Figure 3. This failure is contributed by both narrow inlet channel and lack of high hydrophilicity of the glass surface of the microchamber. In practice, the DNA increases by a factor of (1+ ) where ( is the cycle efficiency. 2 Current PCR applications The area of PCR applications has extended across the range from genomic and developmental biology to medical diagnostics, forensic investigation and environmental analysis. The efficiency of and results from DNA amplification are easily affected by controlled variations in reaction conditions, which may lead to significant difference in results due to the exponentially amplifying nature of PCR. A cross-polarization scheme, placed on the both side of the chamber, was used to mask the pump light from the signal detector. In the mean time, the number of miniaturised devices patented has also increased. The evaporation method involves heating the required material that is to be deposited onto the substrate in a vacuum chamber to high temperatures, usually by passing a high current through the substance. 4 Comparison between fluorescence signals for the same standards of the Quant-iT kit measured by three detectors; microplate-reader, HR4000 ocean optic spectrometer and prototype photo-detector Table 4. Likewise, the award-winning novel... In the result of new novels creation, Rushdie came to the conclusion that a hybrid identity is a perfect strategy for Indian nation to identify their migrant identities. During thermal cycling: (1) Gas bubbles are easily generated in the micro-channels, which adversely affect PCR amplification. The PCR efficiency was first calculated according to the formula: Y = (X+1) Equation 1. 1%. 17 and 3. Detector is a device that responds to some characteristic of the system under observation and convert that responds into a measurable signal. Theoretically, as in Equation1: Equation 3. Fluorescence intensity Figure 4. 9 and Figure 3. 6 pmole) (1. This is the basis for the 5 to 3 directionality of DNA. As a result, a high biomass culture of E. Phosphate-bond molecules link to deoxyribose sugar molecules to form the main stricture of the strand. These factors include quality and quantity of components such as DNA template, polymerase enzyme, and various chemical components, as well as the performance of thermalcyclers conditions (Young et al, 2008) In regard to PCR buffer ingredients, concentrations and, increasingly, PCR pre-mixture are commercially available. Biz Avestimehr Phd Thesis Tudor Dimofte Phd Thesis As The Writer Of A avestimehr thesis Descriptive She is ... 110 133 Figure 4. Nakano et al. 1 this table is an example of commercially available PCR buffer ingredients.. 28x10-9 M), the measurements taken using the prototype photo-detector. 5). 22 Calibration plots of DNA salman avestimehr phd thesis standards on Micro-plate reader. Figure 4. PI polyamide. Avestimehr phd thesis. At first, Aziz gets acquainted with the body of his wife in a fragmented manner: “So gradually Doctor Aziz came to have a picture of Naseem in his mind, a badly-fitting collage of her severally-inspected parts. Coli (K-12) cultures were then distributed to 4 similar aliquots of 1. Molecules of certain compounds known as fluorophores can absorb light at a defined wavelength and almost instantaneously re-emit the light at a longer wavelength or lower energy. Subsequently, it can be concluded that the shunting model is the best for PCR application due to the following reasons: (1) Shunting the PCR mixture in a chamber is essential to prevent any cross contamination especially for designing a portable device, as this device can be used in a non-decontaminated environment. (Lab-on-chip. They are commonly fabricated by methods like hot embossing and injection moulding. The double-stranded DNA has to be heated to C in order to separate the strands. The detection limit was estimated both theoretically by means of the regression analysis, and experimentally. It consists of a PDMS reactor chip, miniaturized thermal cycler and a fibre- optic fluorescence excitation and detection module. The detection limit is defined as the smallest concentration that can be reported with a certain level of confidence i. Salman Avestimehr Phd Thesis - bestbuypaperessay. The polymerase enzyme is a heat stable enzyme, and the denaturation temperature is partially inactivated by the polymerase enzyme and then a fine balance between enzyme inactivation and template denaturation is established. There are two types of real-time-pcr: probebased and intercalation-based. 2. The temperature profiling of the system was then tested using the pre-calibrated temperature sensor. A micro device with a chip size of 7. CTAB (Hexadecyl Trimethyl Ammonium Bromide) extraction method (Murray HG and Thompson, 1980) MEMS MicroElectroMechanical System is a fabrication technique used for developing Micro and Nano systems. The setting was verified using a spectrometer (HR4000, ocean optics, USA) as control spectrometer to evaluate the prototype photo-detector results Optimization of Fluorescence Detection: System Calibration The fluorescence light is transferred by means of the optical fibre to the detection unit. (Jia et al, 2007). A lock-in amplifier is then used to recover the signal while removing the noise and interference. 4) The float was removed from the water bath and the tubes were opened, then 100 µl of the pre-warmed 5M Sodium chloride (NaCl) (Sigma Aldrich, UK) and 80 µl of pre-warmed CTAB (Sigma Aldrich, UK) solution were added to each tube. Without a careful design to administrate temperature uniformity and the elimination of any possible differences in amplification, the reliability, repeatability, sensitivity, efficiency and specificity of PCR amplification across the different chambers may be compromised. The first plan was a front-face arrangement, which was applied by directing the light source through a fibre optic at geometry of 20 degrees and by collecting the signal at 90 degrees. The experiences of migration have influenced to the greatest extent on a formation of a diverse identity of a character. This text contributes to the significance of the entire story as it signifies the positivism of Mondo, which enables him to see the brighter side of everything and people he encounters. The fabrication techniques applied are soft photolithography and replica processes. UV is the Ultra Violet light. The experiment was performed to determine if the concept of the optical device should be pursued further and to define the smallest emission signal which could be detected by the photo-detector. A PCR reagent mixture is introduced into a polymer chip by dropping it onto the inlet of the polymer chip Then, the chip is inserted vertically into a slot of the preheated blocks and the three zones of the loop channel in the polymer chip are heated to three different temperatures for PCR. A black hard paper was placed underneath the chip in order to minimise the effect of the excitation 116 139 light. 4 Conclusion An optical system for the end point detection of PCR was developed in several stages. (prototype device) for primer set Figure 6. Once the photoresist has been exposed to UV light it is then developed in a developer solution removing certain parts of the photoresist (exposed or unexposed), forming the desired pattern (C). 111 134 The problem is solved by using an intensity modulated optical source and a lock-in detection system. The chip was made from Cyclo-Olefin Polymer (COP) as it has a high glass transition temperature to sustain the temperature range required by PCR, has a good UV transmissibility to allow in situ UV-curing of the PPM and low auto-fluorescence to allow on-chip fluorescencebased detection of amplicons. (B) Schematic diagram of laboratory-made microheater using flexible thin film heater (Li, Xing, and Zhang (2009). This DNA was used to carry out all the PCR tests either in the conventional PCR machine or in the prototype device. 21 This graph was plotted using spectrophotmetric data used to define experimentally the LOD of the prototype photo-detector. 3 PCR mathematical model Polymerase chain reaction is the name of an enzymatic process related to three terms: Polymerase because the only enzyme involved in this reaction is DNA polymerase; chain because the products of the first reaction become substrates of the following one, and so on; reaction because the method progress depends upon enzyme synthetic reaction. 0 Introduction In this chapter, the prototype fluorescence detection unit used for DNA detection will be described and discussed based on the experiments carried out on the system. D. This copy of the thesis has been supplied on condition that anyone who consults it recognises that its copyright rests with its author and that no quotation from the thesis and no information derived from it may be published phd thesis augmented reality without proper acknowledgement. 18 Calibration plots of three measurements on prototype photo-detector show fluorescence intensity against FITC concentration. 19 The picture illustrates the PCR-thermal cycler model, which works by thermosiphon effect. The main applications in medical diagnostic laboratories include the diagnosis of certain genetic diseases and the detection of pathogens, mutation detection and cancer diagnostics. This phenomenon is known as chemiluminescence and the chemical compounds emitting fluorescence known as fluorophores. The PCR reagents pumped in S shape loop of microchannel and cycled back and forth using syringe control. Structures created through the hot-embossing process can vary from 150 nm to 150 µm; however, the limiting factor of the hot embossing process is making the master dye Micro-milling Micro-milling is a mechanical process that is capable of producing microstructures in materials such as polymers; this is achieved by using a small revolving cutting 39 62 tool which then removes areas of the polymer to create the structures in the polymer. 6 PCR Master Mix constituents Table 5. PCR chip with reactants were shunted along three temperature zones in a fine polycarbonate chip. 2) The material selected for the chamber will be optimal for heat transfer to the liquid, and potentially be much thinner than conventional PCR tubes as it does not need to be rigid. Then, we consider a model for a wireless relay network with nodes connected by such deterministic channels, and present an exact characterization of the end-to-end capacity when there is a single source and a single destination and an arbitrary number of relay nodes. Kilo base Pairs (Kbp): A unit of DNA equals to 1,000 base pairs. 15 mm) and a layer of PDMS. Ii 4 Author s Declaration I confirm that all novel material presented in this thesis is solely the work of the author Name: Abbas Ali Abdulwahab Salman Signature Abbas Acknowledgment Foremost, I would like to express my sincere gratitude to my director of study Dr. 20 Based on data in Figure 4. 20 Temperature profile of film chamber achieved by our thermal cycler system. Consequently, batch-to-batch variation of the polymerase enzyme is a substantial factor in this process. (2008) investigated the effect of thermal cyclers on PCR performance. A blue-light LED, which was used as an excitation source has peak emission at a wavelength of 480 nm. The Red Shoe by Ursula Dubosarsky is an inspiring tale for young adult readers belonging to the genre of fantasy fiction. 4 is describing the process. LIMBS as salman avestimehr phd thesis single step cell and DNA isolation method provides rapid DNA release and the removal of denatured proteins from pathogens at the same time. The protocol was as follows: 1) 15 mg of bacterial cells were collected from an agar plate and placed into a clean Eppendorf tube. The process described previously is repeated (trait, product, etc. Most of the biological samples contain a complicated mixture of compounds. Detection of genetically modified food (GM food) and the authenticity of food product are the main useful applications of PCR technique in food analysis. Influenced by the writing and historical accounts of western writers, most of whom are notoriously biased and one sided, we readily jump to the conclusion that it has lifted Asia and the dark continent of Africa out of the wilderness and backwardness and brought to it the fruits of Western civilization. The bases are linked by a phosphate group, joining the 3' position of one sugar to the 5' position of the next sugar. Therefore, the PCR is a technique capable of specifically amplifying a single nucleic acid molecule into billions of copies (Mullis et al 1986). An external magnet is used to drive a small ferrofluidic plug inside the circular microchannel, Figure 2. This step is called annealing. 16a: calibration plots of three measurements on HR-4000 ocean optic spectrometer for fluorescence signal against FITC concentrations. The R value of this plot is R the plot equation is Y = A + B * X Figure 4. It can be seen that there is a significant signal development at wavelength 520 nm. 3. The lids of the tubes were closed and mixed by gentle inversion. 5 ng ml -1 (1. 26 Calibration curve based on data of three fluorescence measurements on the photo-detector. (D) Rendering of top plate. # Description of the design The Similarity The difference 1 Reagents shuttling in microchannel along temperature gradient (Cheng et al, 2005) 2 Autonomous microfluidic multi-channel chip for re-l time PCR (Frey et al, 2007) The system compressed three temperature zones. Thermal-cycler step Temperature of the step Time of the step Denaturation step 95 C 30 second Annealing step 55 C 30 second Extension step 72 C 30 second Construction of the first prototype device The first prototype model presented in schematic diagram is illustrated in Figure 3. There are two types of laser systems that can be used; the choice of system to 40 66 Figure 2. 2) Thermoplastic: a chemical reaction intrinsically makes thermoplastics more usable because they can be simply shaped and reshaped by heating to the glass transition temperature (Tg) and cooling down to room temperature. 9) is consists of the following main parts: the source and the coupling of the excitation light in a 122 147 following conditions: the integration time (msecond) is 250 ms and ADC range is fixed on 50 and locked in average at Results and discussion Optimisation of the Fluorescence Detection system: System Calibration The quantum efficiency (Ф f ) is define as the fraction of the incident radiation, which is re-emitted as a fluorescence at longer wavelength (Vogel s, 2000) Equation 4. T g glass transition Temperature it is a temperature required to transfer the materials from a hard and relatively brittle state into a molten -like state PC polycarbonate PDMS poly (dimethylsiloxane). Chromatography, spectroscopy, electrochemistry and thermal analysis techniques) (Fiorini and Chiu, 2005) Benefits of creating PCR-on-a-chip The concept of lab on-a-chip has shown the possibility of performing all the steps of the PCR amplification and detection on a single chip leading to significant advantages in terms of speed, cost and automation, along with very high sensitivity. These mixtures include buffer dntps and thermo stable Taq DNA polymerase at appropriate concentrations allowing the users addition of template DNA, primers and biological water to obtain the final reaction volume. 1 This full text version, available on TeesRep, is the final version of this PhD Thesis: Salman, A. 97 121 Figure 3. 4 Comparison between the features of the prototype chip and the other microchips models published Table 4. The detection limit of the system was determined on the PCR chip using Fluorescein isothiocyanate (FITC) as a fluorophore dye. According to this formula, the PCR amplification at 100 % efficiency should be able to generate in a quantity of more than 10 6 product molecules per original template molecule after 20 cycles, as described in Figure 40 The following sections will describe systematic PCR reaction and the factors affecting its efficiency Optimisation of PCR reaction In spite of PCR s power and flexibility, a PCR method must be carefully designed and applied only after correct validation. Coli). 10 Three types of continuous flow PCR thermal cycling system, (A); twisting channel continuous-flow, (B); coiled channel continuous flow. The last column outlines the articles that described the models Table 3. 5x10-3 ) (25. S ... However, PCR on-a-chip systems, which have been reported in the literature, have not yet replaced the current systems due to weaknesses in their designs. 2 Results and discussion Increasing surface to volume ratio (SVR) is an important physical phenomenon in microfluidic devices, which is an advantage in many cases due to rapid heat transport and faster reactions related to surface chemistry. 28x10-9 M). The parameter controls are: integration time (in second in the range between 2 to 250) locked in average in the range between (2 to 64), ADC in the range (between 50 to 880) and the ability to save the signal as a numerical unit on an Excel sheet, the signal then processed for calibration. Figure 2. A LOD of 3 µm was achieved for Alexa 532 dye. E. Therefore, the PCR programme will be shorter in this form of sample chamber Time (Second) Denaturation Annealing Extension Figure 3. 9700) and Rotorgene (model No. 128(128 pmole) (7. 3 Where the intensity of the incident is light and is the intensity of the transmitted light, then ) Equation 4. 1. Gene A natural unit of the hereditary material, which is the physical basis for the transmission of the characteristics of living organisms from one generation to another. In order to minimize thermal induced stress and replication errors caused by the different thermal expansion coefficients of the dye and polymer substrate, the thermal cycle should be as low as possible (Becker et al, 1998). 2 The PCR-on-chip models categorised according to the thermal-cycler type used and the chamber model. The companies such as: Promega, Alfa DNA, Bio-synthesis and Invitrogen are now providing PCR pre-mixture. Sarker, Mosharraf. G. PEPE perfluoropolyether. The most distinctive integrated design is the one produced by Baier et al. However, several competing reactions also come about, such as, when the single-stranded DNAs are annealed with each other or the primers also anneal with each other to form a primer dimers. Lock-in measurements require a frequency reference. However, continuous-flow PCR poses several problems. 20 of fluorescence intensity obtained from HR 4000 ocean optic spectrometer, a plot of DNA standards concentrations vs. 5 A selected sample loading failure modes. 0x10-3 ) (12. The PCR chip was fabricated in PMMA substrate by laser ablation. Their design does not differ significantly from the model presented by Northrup et al, (1993). (4) Fluorescence detection is more flexible so it can be used for either endpoint detection or real-time PCR. The SPE domain was cleaned with 2 M hydrochloric acid (HCl) for a total of 1 h. These polymers are appropriate for lithography fabrication method. The sample chamber was inserted horizontally between each pair of blocks at each thermal-cycle step. 4 Diagram showing the hot embossing process steps. A number of investigators have attempted to integrate fluorescence detection with microfluidic chips. (B) The picture shows how a sample loading was failed when the sample stopped at the exit of the inlet bridge channel and failed to flow technical writing into the microchamber. (2) Pressure-driven flow easily produces a hyperbolic flow profile that may lead to progressive sample dispersion. TE buffer is a commonly used buffer solution in molecular biology"te" is derived from its components: Tris, a common ph buffer, and EDTA, a molecule that chelates cations like magnesium ion. The faster the better (Wittwer et al, 1990). Polymeric materials have been explored as more flexible alternatives for the fabrication of microfluidic PCR chambers, especially as the polycarbonate polymer is already adapted to PCR, for example; it is used to generate the conventional Eppendorf tubes. Although this is a conventional and well understood method, it is very rarely used due to poor layer adhesion (Fatikow and Rembold, 1997) Hot Embossing The process of hot embossing involves pressing a master dye into a polymer at a temperature above the glass transition temperature (Tg) of the polymer. Compared to these large systems with high power requirements, compact excitation sources (light emitting diodes, LED) and optical sensors (photodiodes and photomultiplier tubes) have been used to perform the fluorescence detection. The salman avestimehr phd thesis miniature thermal cycler is built with a thin film heater for heating and a fan for rapid cooling. B. Thermal cycling profile demonstrates excellent heating and cooling rates and great uniformity. However, the smallest concentration measurable by the prototype photo-detector measurements was 7. 1A and B. 3) The tubes were placed in a float and incubated in the water bath at 55 o C for 30 minutes. The sample is pumped through a micro-channel tube cycled in the region of the three zones. Which deoxyribonucleotides are added is dictated by base pairing to the xix 21 template DNA chain. 2 Chemical structure of double strand DNA molecule illustrating that the main structure is repeating units called nucleotides. This is due to low frequency optical interference and low frequency noise. PP polypropylene. However, due to the complexity of the Gaussian model, except for the simplest networks such as the one-to-many Gaussian broadcast channel and the many-to-one Gaussian multiple access channel, the capacity region of most Gaussian networks is still unknown. The number of cycles also affects the specificity of reaction because the extra cycles may enhance the primers to anneal with non specific regions on the template. There are two main physical vapour deposition (PVD) techniques; evaporation and sputtering. The most effective amplification had been seen at 40 cycles. 6. FITC Fluorescein isothiocyanate isomer I is a green fluorescent dye. Progressive utopianism is aware of the past while at the same time offers a tentative, non-idealized, and hopeful picture of diaspora ethics related to the associated practices in daily life (Bekers & Helff, 2009). ” It can be equated to membership to a religious grouping or community, this being regardless of the person’s religious activity or participation. 28 Chapter 2 Literature review... 4x10-3 (6. In the second cycle the primers anneal to the new single strands of DNA synthesized from the first cycle. FITC dye was used in a proof-of concept demonstration setup, where the detection limit for fluorescence detection was investigated. Whether you are restaurant thesis writing a short examples of thesis statements on education essay or a purdue phd thesis latex ... LOD of the photo-detector fluorescence measurements, which had been measured using the prototype chip was 1. , 2001; Matsubara et al. The sensor was connected with an electronic controller to control the temperature in the zone. 79 104 with the Labview software to formulate all the calculation required and to display the results The second prototype thermal-cycler design and fabrication The previous design was a proposal, but the actual circular design was built from segments as described below. It may be referred to as a specific type of Identity formation focusing mainly on group membership and the importance of the membership as pertaining to self-conception of... However, due to the complexity of the Gaussian model, except for the simplest networks such as the one-to-many Gaussian broadcast channel and the many-to-one Gaussian multiple access channel, the capacity region of most Gaussian networks is still unknown. 26 49 The opportunity for microfluidic research in this field is to fabricate the implementation and integration of a complete analytical device in one chip. CCD charge-coupled device it is a device for the movement of electrical charge to typically to digital value. Therefore, a production of an integrated analysis system requires additional expertise and the technology must be developed before true nucleic acid lab-on-a-chip systems, which can handle a wide range of samples, are routinely generated and become commercially available (Li, Xing, and Zhang, 2009). A LOD of 3 mm was achieved for Alexa 532 dye using this method. 0 degree per second and decreased from ~92 C to 60 C in the rate of ~1. 63 86 Wang et al, (2009) presented a micro PCR chip system incorporated with a fluorescence detection module for on-line detection of infectious diseases. We also characterize the multicast capacity of linear finite-field deterministic relay networks when one source is multicasting the same information to multiple destinations, with the help of arbitrary number of relays. The researchers produced many types of this model. 1) Excitation The goal is to direct (focussing needs a lens) the excitation light by means of a cylindrical tube onto a small vertical line in the centre of the reaction chamber (Figure 4. The R 2 value of the best fit is = Figure 4. (Fery et al, 2007). 23 Based on data in Table 4. For quantitative PCR detection, Electrochemiluminescence can also present an alternative detection method. 18 The chip being used in the final shape Finally, the pieces were soaked by isopropan-2-ol (Analar grade, BDH) to ensure clear surfaces. It provides a predominantly flexible tool for the research scientist and clinical laboratories, due to the simplicity in implementation and reliability of the PCR. The temperature sensing probe used was (Thermocouple Type: K from Farnell), temperature measuring range of the sensor from - 50 C to 350 C. 15 Schematic diagrams of the one well and four well PCR chip design. In DNA, the nucleotide bases are adenine (which pairs with thymine) and guanine (which pairs with cytosine). For the FITC calibration stock solutions of FITC solution were prepared fresh by dissolving 1 mg of FITC dye in 20 ml of phosphate buffer saline (PBS) to obtain a standard solution in concentration of 0. The R value of this plot is R 2 = the plot equation as indicated in the graph. OLED Organic Light Emitting Device. However, the minimum time for the denaturation step during thermal cycles is theoretically less than one second (Wittwer, at el, 1990) 2) After separating the DNA strands, the temperature is lowered so the primers can attach themselves to the single DNA strands. The thermal-cycling device was constricted using three pairs of heating plates. In the optimum annealing, the single-stranded primer molecules are annealed only to the target sequence on the single-stranded DNA template. The annealing step is also a heat sensitive process, as the time and temperature are important to optimizing the signal to minimize non-specific binding of primers to the template (Zhang et al, 2006) A major factor inhibiting the reproducibility and comparability of PCR results is a temperature control over the PCR phases. Denaturation temperature is very important to achieve a successful PCR process as inadequate heating leads to failure in the complete separation of the DNA strands. The curing process could be accomplished by either exposing the material to a high dose of radiation, such as Ultra Violet light (UV), or heating the polymer to a defined temperature (Tg). Woolley et al,(1996) presented a successful model of a stationary PCR chamber as they 57 82 Figure 2. Afterwards the substrate can be further processed by either etching (wet or dry etching), or by deposition of materials such as metals. Molarity (M) is the number of mole of specific chemical dissolved in one litter of solution. 5. 1 List contains the parameters of the thermal-cycler program, which used for temperature measurements. This relationship became the standard way to express the overall efficiency of PCR processes. 5) ng ml -1 (0-1. 1 picture (A) illustrate how the thermister was inserted into the tube positioned inside the thermal-cycler block during the temperature profile test. Therefore, the cycle time is set by the thermal capacitance of the metal block and the heat transfer through the reaction tubes (Bustin, 2010, pp 48-50). The sample chamber in this system was a channel and the liquid sample was shunted back and forth over the three heaters. 25 48 Figure 1. The noiseless nature of this model allows us to focus on the interaction between signals transmitted from different nodes of the network rather than background noise of the links. In communications, the multiuser Gaussian channel model is commonly used to capture fundamental features of a wireless channel. The investigations showed that the system was capable of performing PCR amplification with different annealing temperature ranging from 54 to 68 C, targeting three different sizes of PCR products of 250, 552 and 1500 bp. This method was repeated in different atmospheric conditions although no significant variation in the results was found. Salman avestimehr phd thesis; salman avestimehr phd thesis On the example of his novels “Midnight’s Children”, “Moor’s Last Sigh”, “Shame” and “Fury” a theme of migrant identity in these novels is discussed further on. 3 Mechanism of fluorophore reaction to the dsdna molecules. 01%. The smallest concentration detectable experimentally by HR4000 Ocean Optic spectrometer and prototype photo-detector in the chip was 12. 2) 500 µl of the lysis buffer were added to each tube containing 15 mg of cells and the cells resuspened carefully in the lysis buffer. In chemical molecules, each electronic state has several associated vibration states. The blue LED (LUMILEDS - LXHL-NB98 - LED, LUXEON, STAR, W OPTIC, BLUE, Farnell -UK) was used. 4 Schematic diagrams describing the three processing steps of PCR technique. Religious identity thus refers to “a people’s ways of relating to their religion, salman avestimehr phd thesis including their association with a certain religious community, the strength of their belief in the preferred religion, and their ways of demonstrating those beliefs in their day to day lives. At the surface of the chip, light rays will be reflected by means of total internal reflection and they will propagate back through the reaction chamber, while the fluorescence will be collected by the fibre optic toward the detector. This setup was useful but the signal obtained was poor, as can be seen in Figure 151 Figure 4. The benefit of fluorescence is that can be used to quantify chemical compounds. 4: 107 131 3. 3. Polycarbonate film was bonded to the silicon wafer using double-coated tape with a thickness of 150 mm. A calibration curve was finally constructed and by analyzing the background noise distribution obtained for methanol without FITC in the reaction chamber, detection limits were estimated for each serious of measurements. The optimum denaturation temperature depends upon the base sequence of the target DNA. 2 and it was used to perform PCR tests in both conventional thermal-cycler and in prototype device. The prototype design and the optimisation steps of the detection system will be discussed. , (2002) and Giordano et al, (2001). Unpublished PhD Thesis. In order to define the optimum setup of our experiment, the previous setup was tested in different ways. The number of cycles required to accomplish optimum amplification is mainly dependent on the efficiency of each reaction step and the concentration of the DNA template. The most popular examples of thermoplastics are: poly (methy methylacrylate) (PMMA), polycarbonate (PC), poly olefin copolymers (COC) and poly olefin polymer (COP). PCR technique devices in many application fields demand many improvements, mainly including decreased cost of production and use, decreased time of nucleic acid amplification and reduced consumption of biological samples necessary for PCR. Dry etching covers a wide range of techniques but the three main types of dry etching are; plasma etching, reactive ion etching (RIE) and deep reactive ion etching (DRIE). 24 47 During the rapid PCR, the hold time required for each step is adjusted according to the size of target region. 25x10-3 to 15. -The whole device is disposable. Every inherited characteristic has its origin somewhere in the code of the organism's complement of DNA. The bottom PDMS layer is for liquid micro-channels. The typical example of this kind of polymer is SU-8, which could be a cured by (UV). The measurements were taken using an HR4000 ocean optic spectrometer. The evaporated material then condenses onto the surface of the substrate. The base pairs are connected by Watson-Crick base pair links adenine (A) is always paired with thymine (T) and cytosine (C) with guanine (G) in double strand DNA molecules. Primer used Nucleotide sequence Target gene Primer set 1:F AS_GC356 Primer set 2:F R R AS_519 Primer set 3:F 11 R `-CGCCCGCCGCGCCCCCGCCCCGG CCCGCCGCCCCCGCCCACTCCTACGGGA GGCAGC-3` 5`-GTATTACCGCGGCTGCTG-3` 5`-AGCAACAGGCAGCAGAGGCG-3` 5`-GACGTTCGCGCTGTTTCGGC-3` 5`GTTTGATCCTGGCTCAG-3` 5`GGTTACCTTGTTACGACTT-3` 16S rrna gene flavoprotein FixA in (E Coli) Near complete 16S rrna. 5) has three functions: focusing the incoming excitation beam onto the reaction chamber, filtering of the excitation light and collection of fluorescent light. The whole system allows for developments of low cost, easy to use and portable instruments. Despite the low thermal diffusivities of polymers, a thin film polymer is promising (Becker and Gartner, 2008). 5. 1: This table demonstrate comparison between our device and the similar proposed devices already published, the judgment based on the main key features required to built Point-Of-Care devices Table 6. Coli (K12) with an optical density of was used to extract high quality and high quantity DNA Bacterial Growth Typically, the optical density measured in a spectrophotometer can be used as a measure of the concentration of bacteria in a suspension. This problem was resolved by applying elastomeric valves and laminar flow, which were used to isolate SPE solvents from the other domains without compromising DNA extraction. 22 Wang et al, (2009), demonstrated a fluorescence detection setup based on geometry of 20 degree of excitation source and 90 degree of a detector. Coli (K-12) culture was grown in nutrient broth medium (Oxide, UK) and incubated for 24 hours at 37 C with shaking at 120 rpm. 18, and the wells and channel held the samples in close proximity while preventing cross contamination. 3 Metal Deposition Figure 2. The polycarbonate PCR chip was fabricated using milling and thermal fusion binding for sealing of the cover. The detail of the equation was described in Appendix 1. And the right side illustrates the excitation peak (blue) of SYBR Green 1 at 480 nm and the emission peak (red) at 525 nm (Bustin, 2004). (B) Rendering of PCR card assembly: (1) PP film; (2) structured PC sheet; (3) Al foil; (4) thermocouple, top; (5) thermocouple, bottom. Then the altered tube with thermister was placed in the thermal cycler block. Each pair of blocks were attached together to form a double side temperature zone and soft spring flaps were placed on the other side to in order to slot in the sample chamber between the heaters. 120 143 4. 6, there was a significant signal obtained from standard 1, which had a concentration of 100 ng ml -1. Basically, the PCR process consists of a series of thirty to forty cycles. The calculation of the connection between the thermistor and the data-logger is described in details in Appendix 1. However, the optimal denaturation temperature and the optimal time required to achieve this goal still needs to be validated according to application and thermal-cycler efficiency. The magnetic beads are then loaded into the fluorescence spectrometer which contains an electrochemiluminescent detection chamber. One such example of educating material that makes up the content of primary school education is the use of satirical graphic novels that use wit and irony to bring out the real nature of a topic. Moreover, the fabrication techniques available for the extraction, lyses and analysis components are not always compatible, so substantial design and manufacturing work has to be completed to make these components combinable. The sugar molecule in the RNA is Ribose Principles of PCR technique Enzymatic in-vitro amplification of nucleic acids has revolutionised the life science research and prompted numerous advances in biotechnology and analytical applications. This step must be accomplished in each PCR cycle. The experiment was performed by using ultra thin close tolerance thermistor (Farnell-UK) and data was collected by data-logger from Pico Technology (UK) (device type is ADC-24). 19: calibration plot for the fluorescence signal of FITC standards were obtained from chip measurements using an ocean optic spectrometer. PMMA poly(methyl methacrylate). DNA fingerprinting has been implemented worldwide for forensic investigation. In the ground electronic state, almost all electrons occupy the lowest electronic state. An optic fibre length of 45 centimetres and diameter 600 µm (MM Patch Cables, Thorlab, USA) was used to convey emitted light from the detection microchip through the emission filter as the emission filter was sited directly on the objective chip. 66 89 Figure 2. Each pair was assembled by 18. There are two reasons motivating the researchers to prefer this model of PCR-on-achip: (1) The ability to accomplish thermal cycling in a clean separated sample chamber. The proposed device will be integrated real time PCR system with florescence detection. Before starting the calibration of thermistor, the thermometers were calibrated. Detection of genetically modified food is accomplished using either a by PCR method or a protein based method. 44 67 2. 0x10-3ng ml-1fitc Figure 4. The PDMS layer and the glass base are permanently bonded by bringing both surfaces together after plasma treatment. Edel et 137 160 al, (2004) have demonstrated the use of polyfluorine based (polymer LED) as light source, avalanche photodiode as a detector with limit of detection (LOD) of 1 µm for fluorescein dye. 5 of fluorescence intensity obtained from the photo-detector, a plot of DNA standards concentrations vs. The typical extension temperature is ~72 C because the extension process is carried out using a thermostable DNA polymerase enzyme. During this incubation as the lysis of the cells is taking place the tubes were mixed by gently inverting them every 10 minutes. This method requires amplification of PCR with two types of primers; one primer is biotinylated and the other one unmodified primer. Figure 2. Lab-on-a-chip devices phd thesis collection of papers are generally miniaturised versions of current lab processes, which have been scaled down onto a microchip format, where as Micro Total Analysis Systems are generally devices which have all process steps, integrated onto one device. 2 Materials and methods Design of the system The optical system (Figure 4. Nagai et al. Real-time (PCR) is used for greater accuracy in quantization and has a detection limit of 0. An aluminium film chamber is a high-quality option in term of heat transfer but it is not inert to PCR reactions. Figure 2. Theoretically, duration of less than 1 second, could be used here like the denaturation time (Wittwer, at el, 1990). Modulating the source shifts the measuring signal up the frequency spectrum and away from the low frequency noise. The laboratory-based study of Saunders et al. Serial low concentrations of FITC were prepared and fluorescence measurements were taken using the chip. The off-sidewall area were not filled because of the air trapping caused by the blockage of the microchamber air venting exit by the fast moving liquid along the sidewall. Each plate contains three segments arranged in the circular form, as illustrated in Figure 3. The primers, free nucleotides, and a heat-stable DNA polymerase are present in the vial as the temperature is lowered to ~60 C. The noiseless nature of this model allows us to focus on the interaction between signals transmitted from different nodes of the network rather than background noise of the links. The 3 26 multiple strand displacement amplification (MSDA) technique is similar to SSDA, with the only difference being that during extension of the complementary strand; new annealing sites are generated for the first primer. The main advantage of the flow-through PCR is its ability to reduce the heating and cooling time and thus shorten the total time of the PCR reaction. The complication is related with the fabrication of thin film capsules and using it to perform the PCR process. FITC concentration X axis against fluorescence intensity y axis: the R 2 value of this plot is R= ; the plot equation as indicated in the graph. The fisherman taught Mondo the alphabet in this manner as he believed in the interconnected of nature and the lives of human beings (Wilmington). The fabrication technique used to produce this chip is photolithography in two steps and then polycarbonate film was bounded using double-coated tape. The main purpose of constructing this design was to enhance heat transfer from the blocks to the sample chamber. Gene The three sets of primers were used to perform the PCR tests on the prototype device and the results obtained were tested on agarose gel electrophoresis as a standard method to analysis the size of the DNA amplicons PCR Primer Set 1(250 bp) The first primer set sequences were as follows: AS_519 as a reverse primer: (5`- GTATTACCGCGGCTGCTG-3`) and AS_GC356 as a forward primer: (5`CGCCCGCCGCGCCCCCGCCCCGGCCCGCCGCCCCCGCCCACTCCTACG GGAGGCAGC-3`). This orthogonal fluorescence detection setup provides a geometrical separation of excitation light and fluorescence emission. 2 pmole) (2. The process involves various fluid manipulation components (e. 14, the system is efficient enough to determine the fluorescence signal from the prototype chip and the experimental setup is an effective unit for this size of chemical sample in the chip. Xiang, Xu, and Li (2007) reported a new chip-based real-time PCR system. Two researchers have used PET film to produce PCR chambers, as can be deduced from Table 3. Genequantification. The PCR chip consisted of three layers: two polycarbonate films, thickness 127 µm (0. 4) Optical Integrity: optical filters become cloudy with use so their replacement may improve excitation intensity In-situ Photo-detector The photo-detectors work by converting the light energy to an electrical signal. 22 Calibration plot of DNA standards on a microplate reader. PE polyethylene. E. A summary of the data regression analysis and LOD is shown in Table 4. The peak in a signal of 5800 is illustrating the emission signal obtained from dye in the chip-reaction chamber. However, glass and silicon is known to be a source of PCR inhibition. POC it is a Point of care device or portable device. Table 2. 1Introduction Fabrication materials Fabrication Method Photolithography Etching Metal Deposition Hot Embossing Micro-milling Micro Injection Moulding Laser Ablation The problems associated with PCR-on-a-chip Evaporation and its Inhibition Measures Formation of gas bubbles and Inhibition Measures Integrating system for nucleic acid analysis on-a-chip PCR Microchip Designs Model one Continuous-flow- PCR Model two: stationary chamber-based PCR Model three shunting PCR system Detection method Summary of literature review and conclusion... After several cycles, a sample-containing target DNA will produce a florescence signal that can be distinguished from a base line signal. The reaction chamber made by Jia et al (2007) was fabricated in a planar format. 5 mm thick square-shaped sheet. The device is practically portable and affordable for pathogen diagnostics. 15 Graph (a) illustrating the background signal measured by HR4000 ocean optic spectrometer; graph (b) illustrating the background signal measured using the prototype photodetector. This step is called melting; it breaks apart the hydrogen bonds that connect the two DNA strands. The time required for this step is between 1 to 2 minutes in conventional PCR machines. Salman avestimehr phd thesis filipina saipan lord of maine and they continue to. Tg is the glass temperature of the polymer. The whole polymer chip was made from polycarbonate and fabricated using injection moulding technique. Buoyant convection is generated by the density differences among the heated zones, and a continuous circulatory flow is formed along the loop channel in the polymer chip. 5. However, it is difficult to separate the different temperature zones, to examine the PCR results or to collect the PCR product for further analysis (Easley, Karlinsey, and Landers, 2006) The shunting-pcr model combines the advantages of both previous models, as the sample chamber is cycled between the three temperatures zones, allowing the sample to stay at a specific temperature zone for known residence time according to the program. 064x10-4 (0. These models possess the merits of both static chamber and continuousflow PCR devices. Wang et al, (2009) demonstrated a fluorescence detection system in the chip capable of detecting 10 copies of hepatitis B virus. 2 Results and discussion Thermistors calibration method The objective of this experiment is to ensure the reliability and accuracy of the thermistor temperature measurements. The difference in wavelength is called stokes shift. The clear aperture for imaging the reaction chamber is 5 mm in diameter which is 100 % of the area of the mm 2 square chamber. 5). A contact and noncontact heating system (Giordano et al, 2001) as well as Joule heating system (Hu et al, 2006) were used to power the thermal cycling. 99 122 Figure 3. This thermal-cycling model potentially improves PCR efficacy because it increases the ramping rates for heating and cooling the PCR mixture. The mathematical model of heat transfer in response to PCR systems will also be described. 11 (A) Schematic diagram of the continuous-flow PCR device: the thin film heaters (a), (b), and (c) for denaturation (94 C), annealing (54 C), and extension (72 C), respectively, and (d) the thermally insulated plastic core. The essay The Red Shoe by Ursula Dubosarsky and Stardust Novels by Neil Gaiman explores the modification of childhood’s concept through an analysis of two children’s novels. Liao et al, (2005) demonstrated a portable RT PCR system. The three pieces were placed in the oven at 165 C for two hours under pressure of 12. As can be seen in Figure 2. The transition time from denaturation to annealing and from extension to denaturation has no function i. Yao et al, (2005) fabricated a microfluidic device with an integrated organic LED (OLED) excitation source and a photomultiplier tube (PMT) as detector for on-chip fluorescence detection using a pinhole and interference filter for masking the excitation light. 1 The temperature profile of the polycarbonate-chip is shown for the standard cycling parameters used on the prototype thermal-cycler. The absorption efficiency of the fluorophores, expressed as an extinction coefficient (e), represents the energy captured by one mole of the salman avestimehr phd thesis dye. With a relatively low-cost, mechanically simple and small instrument, there is a potential for much wider application than analysis in centralised laboratories. The thermistor measured the temperature every minute and at the same time the temperature readings were recorded manually from both thermometers Thermal-cyclers temperature profile measurements The thermister was inserted inside a polypropylene 0. All measurements were repeated three times. 4. 16 AutoCAD diagram illustrates the chip design and all the dimensions of the chip features, unit measurement is millimetre for all. Even though these micro systems can perform nucleic acid amplification and detection on a single chip, it still requires a relatively complicated process to integrate these devices. 8 degree per second. E. A diameter of 5 mm was used in this study to allow access of fluorescence detection. ) again and again to produce millions of copies (amplicons) of the desired strand of DNA. The surface area of the chamber is 28. After further processing of the substrate, by either etching or deposition the remaining photoresist is removed Etching The etching process removes any areas of the substrate that is not protected by a photoresist layer. 100 y = 6E-05x Time (seconds) Figure 3. This model shows a potential attainment in terms of a heat transfer study. (2009) The researchers had demonstrated a lab-on-a-chip system capable of hands free automatic sample preparation and nucleic acid extraction from complex samples. After 30 cycles, the desired DNA fragment may be multiplied more than 1 million-fold (Brown, 2001). 5 % Sodium dodecyl sulfate (SDS) (Sigma Aldrich, UK). In this protocol vortex never 157 180 used as it will damage the DNA and clean tubes tips were used between each tube to prevent cross contamination which will not only affect results but will contaminate the solutions used. This technique can be used for a number of different things, such as drilling, patterning, cutting, as well as annealing of materials such as metals, plastics, ceramics, semiconductors and glass. As visible light passes through a cell suspension the light is scattered. µ-tas Miniaturized Total Analysis System. Compared with the conventional gradient PCR machine, the proposed system has several obvious advantages including, simple, inexpensive, faster amplification rate, easy operation and portable. However, if the molecules were excited by a particular light source or temperature, the electrons were promoted to the higher electronic shell or vibration state (Schulman, 1985). 25 µl of biological water (Promega grade water) was then added to the tube and the thermal cycler was secured as a normal run (as can be seen the, Fig. The electron then remains in this level for a very short time, 10-8 to 10-7 seconds. Coli Escherichia coli is a gram-negative bactria. However, the minimum time required to accomplish each PCR step depends upon the melting temperature (T m ), concentration of the primers and the stability of the DNA polymerase (Wittwer et al, 1990). Concentration in ng ml -1 Concentration in nm(10-9 M) (2. The suppliers of thermo- stable DNA polymerase provide 10 time concentrated reaction buffer with the enzyme. A migrant postcolonial identity is reflected on the example of the main characters of the novel by Salman Rushdie. However, if they do match, the polymerase starts to copy the matching piece of the DNA strand. (wang et al, 2009). This layer contains the DNA precipitate which, then washed out by adding 0. The more dsdna present, the more binding sites there are for the dye, so fluorescence increases proportionately to DNA concentration. 5 The optimum reaction mixture of 25 µl reaction used to run the PCR for universal primer for primer set Table 5. An insulation foam layer to isolate the blocks from the ambient temperature and from the adjacent blocks covered the paired blocks. 4 Lab-on-a-Chip Introduction The key function of the microfluidic system is the manipulation and analysis of fluids within micrometre sized channels or chambers. Figure 3. In order to simplify the mathematical description, all the discussion will describe the DNA reaction process as a model PCR amplification process The PCR process is started by one molecule of chromosomal double strand DNA (ds DNA) called the template. 1. They had developed a unique sample preparation method using Laser-Irradiated Magnetic Bead System (LIMBS) for efficient cell lyses and DNA isolation from various pathogens. Prior to the first cycle, the DNA is often melted for an extended time to ensure that both the template DNA and the primers have completely separated. 21, which were ng ml -1 (32. In this case the intensity of the light is proportional to the concentration of the PCR products Duan, Zhou, and Xing (2010) This detection system has gained much attention as an option for miniaturized biosensing platforms, as it provides higher sensitivity and requires less instrumentation than fluorescence methods. 2. The DNA templates that are GC-rich in sequence may require a higher temperature, although the best denaturation is to be as low as possible for the shortest effective time that will maintain the highest DNA polymerase activity in the reaction (Bustin, 2010). 10 schematic diagrams illustrating the normal method used for fluorescence measurements. 0 pg ml -1 ) in both systems. Primer (DNA): A short sequence deoxyribonucleic acid (DNA) that is paired with one strand of the template DNA, in the Polymerase Chain Reaction (PCR) technique. As the PCR process is a temperature dependant, the optimization of the PCR thermal cycler at three temperature steps is a crucial factor in DNA analysis. Sun, Kwok, and Nguyen (2007) also demonstrated a significant model of continuous-flow PCR on-a-chip. (2002);real time fluorescence intensity detection by 72 96 Most of the models produced have facilitated DNA amplification at much faster rates, as the result of smaller thermal capacity and a larger heat transfer rate between the PCR sample and temperature-controlled components. 2 Materials and method The Benchmark Test In order to ensure the consistency in PCR tests, a non-pathogenic E. 9 Dots plot shows the temperature measurements that exhibit that the thermister temperature measurements are identical to the conventional thermometer measurements. This can be done by either wet chemical etching or dry etching and can be either isotropic (all directions at once at the same rate) or anisotropic (in one direction). 1 The total fluorescence intensity (F) is quantified by the equation: Equation 4. 5x10-3 ) 0. During each thermal cycle, the amount of targeted DNA fragment is approximately doubled. Finally, the DNA and PCR measurements on the system will be examined by verifying the results with available standard fluorescence technique. This property of the dye provides the mechanism that allows it to be used to determine the nucleic acids concentrations and to track the accumulation of PCR product. The heating blocks were made from highly thermally conductive metal (Aluminium) to ensure uniform temperature around each block. Since then, this format has been widely replicated and improved. 1 Model one Continuous-flow- PCR The continuous-flow model is a dynamic thermal-cycling solution for microfluidic PCR system. 2. Some researchers claim that the sensitivity and selectivity of the electrochemical detection are comparable to that of the laser-induced fluorescence detection. The attractiveness of this model is that the sample settles at a defined temperature for the known resident s time (Bustin, 2010). As described earlier, nucleic acid molecules are a part of the biological context. 20 Based on data in Figure 4. Optimal temperature and the time required to achieve it depends upon many factors including: melting temperature of the primers; the concentration of the primers; the length and the melting temperature of the product; the activity and stability of the DNA polymerase at different temperature and the thermal-cycler capacity Rapid thermo-cycling The optimum time of PCR protocol depends mainly upon the instrumentation limitation. 24 Maximum emission peaks of serial dilutions of DNA concentrations in the range 0 10 ng µl-, the measurements taken using HR4000 ocean optic spectrometer Figure 4. 3) The material will be selected for optimal optical properties to allow in reaction detection and quantification of the PCR product. The signal illustrated in Figure 153 Figure 4. He formulated a PCR card that contains three layers of saturated polycarbonate (PC) film in between a polypropylene (PP) film and aluminium foil. The fluorescence signal is proportional to the concentration of amplified nucleic acid (Higuchi et al, 1993). E. 3mm). 1: Different concentrations of FITC which were used for system calibration Table 4. D. 14 Design of PCR card and top plate. Picture (B) temperature measurement process. 5 kg weight, which apply a pressure of 245 Pascal. 21 This graph was plotted using spectrophotmetric data used to define experimentally the LOD of the prototype photo-detector. In the further cycles this double stranded DNA will be amplified exponentially until the PCR reagents are exploited. Currently, nucleic acid amplification methods include, but are not limited to, polymerase chain reaction (PCR), single strand-displacement amplification (SSDA), nucleic acid sequence-based amplification (NASBA), rolling-circle amplification (RCA) and the Q β replicas reaction. Fluorescence is the emission, which results from the return of the electron to the singlet ground state. Specifically, the Eppendorf tube was altered in the following manner: the locked-cap was removed and replaced by an adhesive sealed film (PCR adhesive film from (Thermo-Scientific-UK). Polymerase Chain Reaction (PCR): A reaction that uses the enzyme DNA polymerase to catalyze the formation of more DNA strands from an original one by the execution of repeated cycles of DNA synthesis. EDTA is abbreviation of chemical name (Ethylenediaminetetraacetic acid). This application revolutionised forensic science and established a new field of science called forensic biology, which mainly exploited PCR technique as a powerful tool for detecting evidence. During this process the polymer chains start to cross-link. Part of these compounds may inhibit or promote the nucleic acid amplification process in vitro e. 10 Diagram of conventional PCR cycles which focuses on three reactions (denaturation, annealing and extension). The graph obtained is illustrated in Figure As can be seen from the fluorescence signals obtained from venous systems, the prototype photo-detector was more sensitive than the Ocean Optic spectrometer and microplatereader. Coli (K-12) culture was used to extract one lot of chromosomal DNA. At least 600 µl of aqueous layer should be obtained. The spectrometer is used to detect fluorescence accumulation in the PCR reaction chamber. The new double strand DNA is shorter than the original DNA template but longer than the target region to be amplified. This class of polymers can be used to develop fine 33 59 Figure 2. For most miniaturized quantitative-pcr detection systems with stationary or flowthrough chips, bench-top light sources including large lasers and mercury lamps were commonly adopted to excite the labelling dyes or probes. Fast temperature ramping was achieved in this model (Bustin, 2010). 2 summarizes the different types of thermal-cyclers designs that have been published and shows the variations between models in terms of: the heating and cooling rates, sample sizes and the materials used to create the devices. (2005) and Yang et al. 3) The DNA-Polymerase has to fill in the missing strands. 7 Summery of statistical analysis of DNA calibration in the chip for the measurements performed on different fluorescence detectors, the table also shows salman avestimehr phd thesis comparison of LOD in different systems Table 5. The polycarbonate film was laminated with a structured card (made from 1 mm thick polycarbonate sheet) by taking advantage of the thermal binding between the PC of the sheet PC film. The first reason is that the sample in this model is amplified in a clean disposeable chamber and this prevents any cross-contamination. Mullis's original PCR process was very inefficient as it required a great deal of time, enormous amounts of DNA-Polymerase and regular attention throughout the PCR process. The spectrometer is used to detect fluorescence accumulation in the PCR reaction chamber. Figure 3. The system consisted of three parts: six heating blocks (2 2 3 inch), a controlled power supply unit and a temperature-monitoring unit. For the micro injection moulding technique it is important that the mould is heated to the softening temperature of the polymer before the polymer is injected in; this is done in order to prevent hardening of the injected polymer (Rotting et al, 2002). The most common on-line detection 70 93 scheme for micro PCR amplification is based on fluorescence techniques. It was found that the versatile approach to ensure complete denaturation of dsdna is salman avestimehr phd thesis to raise the temperature of the PCR mixture to a deflated degree ~94 C. 22 This illustrates the progress of temperature heated in denturation step inside the chip. FITC concentration X axis against fluorescence intensity y axis: the R 2 value of this plot is R= ; the plot equation is Y = A + B * X Figure 4. 32 to -1. (C) Video snapshots of a liquid loading sequence in a semicircle microchamber entrapping air in the central portion of the microchamber due to non-uniform hydrophilicity on the surface of the microchamber (Gong et al, 2006). 14 The peak in a signal of illustrates the optimum fluorescence signal obtained from the FITC as a Fluorescence dye in the chip-reaction chamber, as the excitation signal is lowe than the emission signal. In theory a filter is not necessary, yet, in practice, scattering of the excitation light will occur so additional spectral filtering of the fluorescence emission is needed as can be seen Figure 144 Figure 4. Table 5. 8. Also, it often requires an external bulky syringe pump which adversely affects the development of compact, portable and integrated continuous-flow PCR chips. 2006) 27 51 long thermal time constants. The full microfabrication steps are described in Figure Figure 2. The binding of the fluorophore molecules to dsdna enhance the fluorescence intensity of the solution and can be easily detected by the fluorometers. In conventional PCR machines, no amplified products are seen when fewer than 20 cycles are performed. They are, in general, heterocyclic or polyaromatic hydrocarbons, characterised by conjugated double bounds and rigid in their structure, as can be seen in the structure of SYBR Green I (Figure 4. (b) Fluorescence intensity of different concentrations of FITC in the range (0 to 0. 5pg ml -1 FITC (32 pmol FITC). This buffer usually contains the constituents listed in Table 45 transfer heat to the reaction mixture through the reaction tubes. This is because the cycle is only defined at one end of the targeted region and the elongation takes place along the DNA template (Figure. Figure 2. 16b calibration plots of three measurements on prototype photo-detector show fluorescence intensity against FITC concentration. The key aspect of this technique, in particular, is a determination of the reaction cycle that gives a significant fluorescence signal called the cycle threshold (CT). Therefore, the DNA template utilized in the project investigation was carefully prepared and tested. 3 The mechanism of phosphodiester bond to attached to the 5`- deoxyribose of an oligonucleotide. 8 pg ml -1 ), which clearly indicated that the prototype photo-detector was more sensitive. The PCR reagents are cycled using conviction effect along a triangular closed loop channel. 4, the first cycle of PCR progress, sample DNA is heated in a vial to 94 C to separate the strands. 7 The table describe the programme of the prototype thermal-cycler applied amplified the designed primer set Table 5. As illustrated in Figure 2. 105 128 At this stage of PCR, the primers anneal to their complementary sequences on target DNA. (a) The geometry of the channel in the polymer chip. 10 The plot indicates the error in the temperature measurement of the thermistor in comparison with the calibrated thermometers. G. This type of cycle has generally occurred in the typical thermal-cyclers machine, as the time required for the temperature transition between steps is taking a longer time than the actual process. 4 in the sample chamber, as the PBS buffer is the sample matrix of fluorophore dye (FITC). Therefore, the challenge is to achieve a practical low cost design of a thermal cycler and compatible detection mode. This system consists of a high output 61 85 Figure 2. In addition, it should be pointed out that flow-through PCR chip microfluidics has generated a great deal of interest from researchers and is demonstrating rapid development, in competition with stationary chamber PCR microfluidics, since it was introduced for the first time by (Kopp, De Mello, and Manz,1998). Fundamentally, the absorption of light by the fluorophores excites electrons to the higher energy level (higher unstable state). This step should be done as quickly as possible so that the solutions are still as close to 65 C as possible. 1 Theoretical background Fluorescence spectroscopy Fluorescence spectroscopy is a highly sensitive technique for the quantitative detection of suitable species, with limits of detection in the parts per trillion (ppt) being reported for state of the art measurements. 0 mm thickness covered by thin polycarbonate film of 127 µm thickness. The diagram shows the orthogonal fluorescence detection setup, which provides a geometrical separation of excitation light and fluorescence emission. As a result, the proof-of-concept of the proposed detection configuration was tested using a prototype disposable polycarbonate chip that could be easily replaced, but ultimately, the future goal would be to adapt this detection approach for online detection of PCR. According to the LED data sheet, the luminous flux will vary from a minimum of 6. Ultimately, the electrode supplies an electric field to the bound material and the electric field and produces light stimulate the TBR-labelled probe, which has hybridized to capture PCR products. The complex nature of a PCR mixture enhances the possibility of interaction between the surface of the reaction chamber and at least one of the PCR components. 2005) 5 The flow-through PCR chip (Wang et al, 2009) Three temperature zones are arranged in circular shape. In addition, precise handling and processing of a sample of microfluidics on such PCR chips still face challenges (Ji et al, 2007) Northrup et al, (1993) introduced the first type of miniaturised PCR in a chip.